Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 10/01/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Berkshire Community College |
| Observations | Was found drowning in Brown sugar & Yeast Trap (Alex Shen), was quickly preserved in 70% isopropyl alcohol Our first PCR reaction was set up on 10/16/2025 and:
|
| Putative identification | Arthropoda Insecta Diptera Sarcophagidae Ravinia Ravinia anxia |
Methods |
|
| Extraction kit | Monarch DNA extraction (NEB) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Edvotek Gel Electrophoresis |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | We used a DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction kit (Product # T3010) The specimen was incubated for 30 minutes in a hot water bath at 56 degrees C Our first Gel image was taken on 10/23/2025 and:
Our second PCR reaction was set up on 10/30/2025, used the same Taq polymerase as the first PCR reaction, and:
Gel image was taken on 10/6/2025 and:
|
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | Due to the false positive DNA in the water control further testing must be done to ensure accuracy After completion of second PCR (single), confidence has been increased to high as controls are proper, two positive control have distinct bands, and presence of Wolbachia remained negative |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download AB1
TGATCAGGAATAGTAGGAACTTCTTTAAGAATTCTTATTCGAGCAGAATTAGGACATCCAGGAGCATTAATTGGAGATGACCAAATTTATAATGTTATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGATTCGGAAATTGATTAGTTCCTATTATACTTGGTGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGATTACTACCCCCTGCATTAACATTACTACTAGTAAGTAGTATAGTAGAAAACGGAGCTGGAACAGGATGAACTGTATACCCTCCTTTATCATCTAATATTGCTCATGGAGGAGCCTCTGTTGATTTAGCTATTTTTTCTCTACATTTAGCAGGGATTTCATCAATTTTAGGGGCAGTAAATTTTATTACTACAGTTATTAATATACGATCAACAGGAATTACTTTTGACCGAATACCTCTATTTGTTTGATCTGTAGTAATTACTGCCTTATTATTACTTTTATCTTTACCAGTTCTTGCTGGAGCAATTACTATACTTTTAACTGATCGAAATATTAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTTTGA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Ravinia anxia was found to be negative for Wolbachia. |






Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)
JTR 1