Flesh Fly

Sample information

Picture
Entry by: Caelan B, Paul, D
Location
Collection date 10/01/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations

Was found drowning in Brown sugar & Yeast Trap (Alex Shen), was quickly preserved in 70% isopropyl alcohol

Our first PCR reaction was set up on 10/16/2025 and:

  • was a duplex reaction because we used both the Arthropod CO1 and Wolbachia 16s primers together
  • used an annealing temperature of 49 degrees Celsius.
  • used this Taq polymerase: New England Biolabs OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer (#M0488S)
Putative identification Arthropoda Insecta Diptera Sarcophagidae Ravinia Ravinia anxia

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system Edvotek Gel Electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We used a DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction kit (Product # T3010)

The specimen was incubated for 30 minutes in a hot water bath at 56 degrees C

Our first Gel image was taken on 10/23/2025 and:

  • was run at 125 volts for ~36 minutes
  • used this DNA Ladder: New England Biolabs 1 kb Plus DNA Ladder for Safe Stains (product # N0559S)

Our second PCR reaction was set up on 10/30/2025, used the same Taq polymerase as the first PCR reaction, and:

  • was a single reaction that used the Wolbachia_F and Wolbachia_R primers
  • used an annealing temperature of 55 degrees Celsius

Gel image was taken on 10/6/2025 and:

  • was run at 125 volts for ~21 minutes
  • used this DNA Ladder: New England Biolabs 1 kb Plus DNA Ladder for Safe Stains (Product # N0559S)

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

Due to the false positive DNA in the water control further testing must be done to ensure accuracy

After completion of second PCR (single), confidence has been increased to high as controls are proper, two positive control have distinct bands, and presence of Wolbachia remained negative

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
TGATCAGGAATAGTAGGAACTTCTTTAAGAATTCTTATTCGAGCAGAATTAGGACATCCAGGAGCATTAATTGGAGATGACCAAATTTATAATGTTATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATGCCAATTATAATTGGAGGATTCGGAAATTGATTAGTTCCTATTATACTTGGTGCTCCAGATATAGCTTTCCCTCGAATAAATAATATAAGTTTTTGATTACTACCCCCTGCATTAACATTACTACTAGTAAGTAGTATAGTAGAAAACGGAGCTGGAACAGGATGAACTGTATACCCTCCTTTATCATCTAATATTGCTCATGGAGGAGCCTCTGTTGATTTAGCTATTTTTTCTCTACATTTAGCAGGGATTTCATCAATTTTAGGGGCAGTAAATTTTATTACTACAGTTATTAATATACGATCAACAGGAATTACTTTTGACCGAATACCTCTATTTGTTTGATCTGTAGTAATTACTGCCTTATTATTACTTTTATCTTTACCAGTTCTTGCTGGAGCAATTACTATACTTTTAACTGATCGAAATATTAATACTTCATTTTTTGATCCAGCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTTTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Ravinia anxia was found to be negative for Wolbachia.
Report Inappropriate Post