Bombus Impatien

Sample information

Picture
Entry by: Harold P.
Location
Collection date 10/01/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations

It was extracting polen with the rest of bees, it is very fluffy under the microscope.

Has wings and has 6 legs.

Putative identification Arthropoda Insecta Hymenoptera Apidae Bombus Bombus impatiens

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Abdomen
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We followed throughly the steps to perform the gel electrophoresis and actually gave us valid results, on the pictures you can appreciate the labels

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

We aren’t very confident in our confidence level because this would be the first one that we perform that actually gives us valid results, but our results show that my arthropod (HP_2) is negative for wolbachia as no bands show around 400 bp.

All of our controls were where they were supposed to, so that is also why our confidence is medium and now low because if we were to see bands on water, would mean we absolutely did something wrong.

DNA sequence for the CO1 gene was a match for a different arthropod, the thick-headed fly (Physocephala furcillata). We are unsure as to why.

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
GAGCAGGAATAGTAGGAACATCATTAAGAATATTAATTCGAGTAGAATTAGGTCATCCAGGAACATTTATTGGAAATGATCAAATTTATAATGTAATTGTTACAGCACATGCATTTATCATAATTTTTTTTATGGTAATACCAATTATAATTGGAGGATTTGGAAATTGACTAGTACCCCTAATACTAGGAGCCCCTGATATAGCCTTTCCCCGAATAAATAATATAAGTTTTTGATTATTACCACCTTCCCTTACATTATTATTAATAAGAAGAATAGTAGAAAGAGGAGCCGGTACAGGGTGAACAGTATACCCGCCACTCTCATCCACTATTGCTCATAGAGGAGCATCAGTTGATTTAGCAATTTTTAGATTACATCTAGCTGGAATTTCTTCTATTTTAGGAGCCGTAAATTTTATTACTACAGTTATTAATATACGATCCCCTGGGATTACTCTAGATCGAATGCCTTTATTTGTTTGATCAGTAGTAATTACTGCACTTTTACTTCTATTGTCTTTACCTGTTCTAGCCGGAGCAATCACAATATTATTAACTGATCGTAATTTAAATACTTCATTCTTTGACCCAGCGGGAGGAGGAGATCCAATTTTATACCAACATCTATTTTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Bombus impatiens was found to be negative for Wolbachia.
Report Inappropriate Post