Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/28/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Berkshire Community College |
| Observations | It was observed crawling outside on deck through cracks of the wood. |
| Putative identification | Arthropoda Insecta Dermaptera Forficulidae Forficula Forficula auricularia |
Methods |
|
| Extraction kit | Monarch DNA extraction (NEB) |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Edvotek Gel Electrophoresis |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | We used a DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction kit (Product #T3010). The specimen was incubated for 32 minutes in a hot water bath at 56 degrees C. Details that differed from the protocol was that the 3 minute centrifuge was very off balance due to the positive control being too low we had to level it out with additional water. Our first PCR reaction was set up on 10/15/2025 and it was a duplex reaction because we used both the Arthropod CO1 and Wolbachia 16S primers together. We used an annealing temperature of 49 degrees C. We used this Taq polymerase: New England Biolabs OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer (#M0488S). Our first Gel image was taken on 10/22/2025 and was run at 125 volts for 15 minutes. We used this DNA Ladder: New England Biolabs 1kb Plus DNA Ladder for Safe Stains (product # N05595). Our second PCR reaction was set up on 10/29/2025, and we used the same Taq polymerase as the first PCR reaction, and it was a single reaction for Arthropod CO1 primers. We used an annealing temperature of 49 degrees Celsius. Something that differed from the written protocol is that when adding the DNA to the PCR tubes we had to add one microliter more than written protocol because it appeared to be too low. Our second Gel image was taken on 11/05/2025 and was run at 125 volts for 21 minutes. We used the New England Biolabs 1 kb Plus Ladder for Safe Stains (product #N0559S). |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The controls provided the results expected and showed that there was no contamination in any of the steps. The positive arthropod control and the DNA control showed bright bands for both C01 and Wolbachia 16S which was expected and the negative arthropod showed a bright band for CO1 which was also expected. The water showed no band which showed there was no contamination in the PCR process. The arthropod sample had a faint line for the CO1 which lines up with the negative control. We did a second PCR for Arthropod CO1 primers but that does not change my confidence level in my results due to the single PCR confirming my previous results. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download AB1
CCTTTGGGGATATGAGCAGGTATAGTAGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACCATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATGGCTTTTCCTCGAATAAATAATATAAGTTTTTGACTATTACCCCCTTCTTTAACTTTATTAATTTCAAGAAAAATTGTAAAAAATGGAGCAGGTACAGGATGAACAGTTTATCCCCCCCTTTCATCTAATATTGCTCATGGAGGTAGTTCAGTAAATTTAGCTATCTTTTCTTTACATTTAGCTGGAATTTCTTCTATTTTAGGAGCCATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACAGCATTCTTATTATTACTTTCTTTACCAGTATTAGCAGGAGCAATTACAATATTATTAACAGATCGAAATTTAAACACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCTATTCTTTATCAACATCTATTTTGATTTTTTGGTCACCTGGGAAGTTTAAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Forficula auricularia was found to be negative for Wolbachia. |





Subfamily Pentatominae
Eastern boxelder (Boisea trivittata)
(no title)
Subclass Pterygota (Winged and Once-winged insects)
(no title)