Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/04/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | Caught by Fall 2025 student of Benedictine University. Retrieved in grassy area near Krasa Hall. |
| Putative identification | Arthropoda Insecta Orthoptera |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Everything went normal during protocols. I had extra DNA after PCR and needed to dilute it. My results went wrong after receiving my gel electrophoresis results. |
Results |
|
| Wolbachia presence | Unknown |
| Confidence level | Low |
| Explanation of confidence level | The DNA after gel electrophoresis resulted with no arthropod DNA band and a thick Wolbachia DNA band. After professionally tested, I received poor quality arthropod DNA that didn’t result in the correct insect when BLASTed. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence |
TAAATCAACGAAGGTTCCTCCGGGACCATTATTTGAAGATAAGGGGGGATATACGGTTCTTCCGTATCCTGCCCCTCTTTCTACT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | |


Blattodea LB2
tenebrio molitor_To1
JC2
YSD2