Oecanthus niveus

Sample information

Picture
Entry by: Gabriel K.
Location
Collection date 09/04/2025
Captive / Cultivated? Wild-caught
Group Benedictine University
Observations

Caught by Fall 2025 student of Benedictine University. Retrieved in grassy area near Krasa Hall.

Putative identification Arthropoda Insecta Orthoptera

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Partial abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Everything went normal during protocols. I had extra DNA after PCR and needed to dilute it. My results went wrong after receiving my gel electrophoresis results.

Results

Wolbachia presence Unknown
Confidence level Low
Explanation of confidence level

The DNA after gel electrophoresis resulted with no arthropod DNA band and a thick Wolbachia DNA band. After professionally tested, I received poor quality arthropod DNA that didn’t result in the correct insect when BLASTed.

Wolbachia 16S sequence
Arthropod COI sequence
TAAATCAACGAAGGTTCCTCCGGGACCATTATTTGAAGATAAGGGGGGATATACGGTTCTTCCGTATCCTGCCCCTCTTTCTACT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary
Report Inappropriate Post