Woolly Worms vs. Boxelder Bugs: Testing Wolbachia Presence

Sample information

Picture
Entry by: Anvi Ramrakhiyani
Location
Approximate location: 35.74, -81.89
Collection date 11/13/2025
Captive / Cultivated? Wild-caught
Group NCSSM
Observations

My group partner and I found this Wolly worm on a sidewalk, near a forest-like place. We saw this Wolly worm in the morning, around 11 AM on a windy day. When we tried to collect the worm in a jar, we noticed that it kept compressing its body and folding up.

Putative identification Arthropoda Insecta Lepidoptera

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

DNA Extraction: Considering our Wolly Worm(s) were bigger than a grain of rice, we had to take the worm apart and pull out some DNA located right within the abdomen.

Gel electrophoresis: We used both an arthropod and Wolbachia primer for amplification, as an arthropod primer helped us understand if the PCR is working properly and our DNA was extracted well. While, the Wolbachia primers helped us understand if there was a presence of such gene.

1- Ladder

3- Wolly Worm #1, Arthropod Primer

5- Wolly Worm #1, Wolbachia Primer

7- Wolly Worm #2, Arthropod Primer (My sample)

9- Wolly Worm #2, Wolbachia Primer (My sample)

(Our controls were conducted by two other group members, who were conducting the same protocols but for a Boxelder Bug (As our final study is the comparative study of Wolbachia presence between Lepidoptera’s (Wolly Worm in this case) and Hemipterans (Boxelder Bugs)

Result Analysis: The Bands are not too bad, considering we can properly see the bp that was amplified by the Arthropod primers, and faintly see the bp amplified by Wolbachia primers.

Results

Wolbachia presence Yes
Confidence level Medium
Explanation of confidence level

I was expecting my gels to work a little more better, within an organized manner.

Wolbachia 16S sequence
not too confident, as they faintly appear
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence
CAAAAAATGATGTATTTAAATTTCGATCTGTTAAAAGTATAGTAATAGCACCTGCTAAAACAGGTAAGGA AAGAAGAAGTAAAAAAGCAGTAATTCCCACTGCTCAAACAAATAAAGGTATTTGATCAAATGATAAATTA TTTAATCGTATATTAATAATTGTGGTAATAAAATTAATAGCTCCTAAAATTGAAGAAATTCCCGCTAGAT GTAAAGAAAAAATGGCTAAATCAACAGAACTACCACCGTGGGCAATATTGGATGAAAGGGGGGGATAAAC AGTTCATCCAGTACCTGCTCCATTTTCTACAATTCTTCTTGAGATTAATAAAGTTAAAGATGGGGGTAAA AGTCAAAAACTTATGTTATTTATTCGGGGGAAAGCTATATCAGGGGCTCCTAATATTAAAGGAACTAATC AATTACCAAATCCTCCAATTATAATAGGTATAACTATAAAAAAAATTATAATAAAAGCATGAGCTGTAAC AATAGTATTATAAATTTGATCATCTCCGATTAAGGATCCGGGTATCCCTAATTCTGCTCGAATTAATAAT CTTAATGAAGTTCCTACTATTCCTGCCCAA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lepidoptera was found to be postive for Wolbachia.
Report Inappropriate Post