Arthropod and Wolbachia Identification – Brown Marmorated Stink Bug

Sample information

Picture
Entry by: Julia L., Alvin Q., Anushka S.
Location
Collection date 09/25/2025
Captive / Cultivated? Wild-caught
Group NCSSM
Observations

Using mason jars and a small mesh net, the Brown Marmorated Stink Bugs were caught from the windows of Goodwin Hall at the North Carolina School of Science and Mathematics – Morganton. All the insects used in the experiment were caught on the same day, around noon.

Putative identification Arthropoda Insecta Hemiptera Pentatomidae Halyomorpha Halyomorpha halys

Methods

Extraction kit Qiagen DNeasy Blood and Tissue Kit
DNA extraction location Partial abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain Cyber Green
Gel images
Protocol notes

 

DNA Extraction: The brown marmorated stink bug was first thoroughly washed with molecular biology-grade water, and then its abdomen was separated from the rest of the body using a sterile pair of tweezers, scalpel, and Petri dish. The reproductive organs were then transferred into a centrifuge tube containing ATL buffer and ground thoroughly with a pestle afterward.

Gel Electrophoresis Lanes:

Red Box: Sample Analyzed
Lane 6: Sample Amplified with Arthropod Primers
Lane 7: Sample Amplified with Wolbachia primers
Lane 10: 
Positive Wolbachia Control
Lane 11: Negative Wolbachia Control
Lane 12: Positive Arthropod Control
Lane 13: Negative Arthropod Control

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

For this brown marmorated stink bug sample, no bands (~438 bp) indicative of Wolbachia presence were observed during gel electrophoresis. The confidence level was deemed medium, since the Positive Wolbachia Control sample result was incorrect.

Wolbachia 16S sequence
Arthropod COI sequence
TAAACTTCCAGGGTGACCAAAAAATCAAAATAAATGTTGATAAAGAATAGGGTCTCCTCCTCCTGATGGGTCAAAAAAAGAGGTATTAAAATTTCGGTCAGTTAATAGTATAGTAATAGCACCTGCTAACACAGGTAAGGATAATAACAGAAGAAGTGCAGTAATTCCTACTGATCACACAAACAATGGGATTCGTTCAGGGGTTATACCTGTTGGTCGTATATTTATAATAGTTGAAATAAAATTTACTGCCCCTAAAATTGATGAAACCCCAGCCAAATGTAAGGAAAAAATAGCTAAATCAACTGATGCTCCTCTATGTGAGATATTACTTGATAAGGGGGGATAGACTGTTCATCCTGTCCCAGCTCCTGATTCTGCTATTCTTCTTATTAATAATAAAGTTAATGAAGGGGGTAATAATCAGAATCTTATATTATTTAATCGTGGGAAGGCTATATCAGGTGCTCCAATTATTAAAGGGACTAATCAATTACCGAATCCTCCAATTATGATTGGTATTACTATAAAGAAAATTATTACAAATGCATGTGCTGTTACAATTACATTATAAATTTGATCATTACCAATAAATCTTCCAGGCTGTCCTAATTCGATACGGATAATTAATCTTATAGCTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Halyomorpha halys was found to be negative for Wolbachia.
Report Inappropriate Post