Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/25/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | NCSSM |
| Observations |
Using mason jars and a small mesh net, the Brown Marmorated Stink Bugs were caught from the windows of Goodwin Hall at the North Carolina School of Science and Mathematics – Morganton. All the insects used in the experiment were caught on the same day, around noon. |
| Putative identification | Arthropoda Insecta Hemiptera Pentatomidae Halyomorpha Halyomorpha halys |
Methods |
|
| Extraction kit | Qiagen DNeasy Blood and Tissue Kit |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | Cyber Green |
| Gel images |
|
| Protocol notes | DNA Extraction: The brown marmorated stink bug was first thoroughly washed with molecular biology-grade water, and then its abdomen was separated from the rest of the body using a sterile pair of tweezers, scalpel, and Petri dish. The reproductive organs were then transferred into a centrifuge tube containing ATL buffer and ground thoroughly with a pestle afterward. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | For this brown marmorated stink bug sample, no bands (~438 bp) indicative of Wolbachia presence were observed during gel electrophoresis. The confidence level was deemed medium, since the Positive Wolbachia Control sample result was incorrect. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence |
TAAACTTCAGGGTGACCAAAAAATCAAAATAAATGTTGATAAAGAATAGGGTCTCCTCCTCCTGATGGGTCAAAAAAAGAGGTATTAAAATTTCGGTCAGTTAATAGTATAGTAATAGCACCTGCTAACACAGGTAAGGATAATAACAGAAGAAGTGCAGTAATTCCTACTGATCACACAAACAATGGGATTCGTTCAGGGGTTATACCTGTTGGTCGTATATTTATAATAGTTGAAATAAAATTTACTGCCCCTAAAATTGATGAAACCCCAGCCAAATGTAAGGAAAAAATAGCTAAATCAACTGATGCTCCTCTATGTGAGATATTACTTGATAAGGGGGGATAGACTGTTCATCCTGTCCCAGCTCCTGATTCTGCTATTCTTCTTATTAATAATAAAGTTAATGAAGGGGGTAATAATCAGAATCTTATATTATTTAATCGTGGGAAGGCTATATCAGGTGCTCCAATTATTAAAGGGACTAATCAATTACCGAATCCTCCAATTATGATTGGTATTACTATAAAGAAAATTATTACAAATGCATGTGCTGTTACAATTACATTATAAATTTGATCATTACCAATAAATCTTCC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Halyomorpha halys was found to be negative for Wolbachia. |



Blattodea LB2
tenebrio molitor_To1
JC2
YSD2