Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/04/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | My specimen showed the typical characteristics of Bombus impatiens: a black and yellow thorax, dense body hairs, large compound eyes, two pairs of membranous wings, and pollen baskets on the hind legs. |
| Putative identification | Arthropoda Insecta Hymenoptera |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Two PCR attempts were performed. The first gel showed no bands possibly due to technical errors, and the second showed faint bands with no Wolbachia band present. Low 260/230 ratio from the DNA extraction may have reduced PCR signal. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | I chose medium confidence because although my gel bands were faint due to my low 260/230 ratio, all of the molecular evidence was consistent. The class controls worked as expected, which shows that the PCR and gel system were functioning correctly. My COI sequencing produced high-quality reads and BLAST reliably matched Bombus impatiens, and the phylogenetic tree placed my sample in the correct Hymenoptera clade. Since every molecular result agreed and no Wolbachia bands or sequences appeared anywhere, I trust that my specimen was Wolbachia-negative, even though my gel signal was weak |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
TGATTAAAATTTCGATCAAAAAGATAAATTGCTCCGCTAAAACTGGTAATGATAAAATTAATAATAAAACTGTAATACAT ACAGATCAAAAAATAAAGTAATTTGATCATAATTTAATGAAAAATTTTTTATTAATATAATTGTAACAATAAAATTTAAT GAACCAATAATAGAAGAAATTCCTGTTATATGTAAAGAAAAAATTGCAATATCTACTGAGGGTGATGAATGAAATAAATA AGATGATAATGGAGGATATACAGTTCAACCTGTTCCTACATTTGGTGTAAATAGAGTTCTTAATAATAGTATAAAAATAG ATGGAGGTAATAATCAAAATCTAATATTATTTATTCGTGGGAAAGCTATATCAGGTGATCCTAATATTAAAGGAATTAAA TAATTTCCAAACCCTCCAATTATAAATGGTATAACTATAAAAAAAATTATTAAAAATGCATGTCTAGTAACTAATGAGTT ATAAATTTGATCATTATTAATTCATATTCCTGGATGTCTAAGTTCTATTCGAATTAATAATCTTATTGATGATCCAATTA TTCCTGATCATATGGCAAAAATAAAATATATTATTCATATCTTTTGA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Hymenoptera was found to be negative for Wolbachia. |


Wolbachia Project
Alexander Devlin-Myrmica
Brookelynn Foote- Coccinellidae
Maile Bentz- Harmonia axyridis
Madison Adams – Harmonia axyridis