Bombus impatients (Eastern Bumblebee)

Sample information

Picture
Entry by: Mariya M.
Location
Collection date 09/04/2025
Captive / Cultivated? Wild-caught
Group Benedictine University
Observations

My specimen showed the typical characteristics of Bombus impatiens: a black and yellow thorax, dense body hairs, large compound eyes, two pairs of membranous wings, and pollen baskets on the hind legs.

Putative identification Arthropoda Insecta Hymenoptera

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Two PCR attempts were performed. The first gel showed no bands possibly due to technical errors, and the second showed faint bands with no Wolbachia band present. Low 260/230 ratio from the DNA extraction may have reduced PCR signal.

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

I chose medium confidence because although my gel bands were faint due to my low 260/230 ratio, all of the molecular evidence was consistent. The class controls worked as expected, which shows that the PCR and gel system were functioning correctly. My COI sequencing produced high-quality reads and BLAST reliably matched Bombus impatiens, and the phylogenetic tree placed my sample in the correct Hymenoptera clade. Since every molecular result agreed and no Wolbachia bands or sequences appeared anywhere, I trust that my specimen was Wolbachia-negative, even though my gel signal was weak

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA   
TGATTAAAATTTCGATCAAAAAGATAAATTGCTCCGCTAAAACTGGTAATGATAAAATTAATAATAAAACTGTAATACAT ACAGATCAAAAAATAAAGTAATTTGATCATAATTTAATGAAAAATTTTTTATTAATATAATTGTAACAATAAAATTTAAT GAACCAATAATAGAAGAAATTCCTGTTATATGTAAAGAAAAAATTGCAATATCTACTGAGGGTGATGAATGAAATAAATA AGATGATAATGGAGGATATACAGTTCAACCTGTTCCTACATTTGGTGTAAATAGAGTTCTTAATAATAGTATAAAAATAG ATGGAGGTAATAATCAAAATCTAATATTATTTATTCGTGGGAAAGCTATATCAGGTGATCCTAATATTAAAGGAATTAAA TAATTTCCAAACCCTCCAATTATAAATGGTATAACTATAAAAAAAATTATTAAAAATGCATGTCTAGTAACTAATGAGTT ATAAATTTGATCATTATTAATTCATATTCCTGGATGTCTAAGTTCTATTCGAATTAATAATCTTATTGATGATCCAATTA TTCCTGATCATATGGCAAAAATAAAATATATTATTCATATCTTTTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Hymenoptera was found to be negative for Wolbachia.
Report Inappropriate Post