Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/04/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | The insect has a long, flattened brown body with noticeable pincer-like cerci at the end of the abdomen. It has short forewings, long antennae, and was found hiding under tree bark, which is a common habitat for earwigs. |
| Putative identification | Arthropoda Insecta Dermaptera Forficulidae Forficula Forficula auricularia |
Methods |
|
| Extraction kit | container |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | agarose gel electrophoresis |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | In Lane 2, which contained my European earwig (Forficula auricularia) sample, the gel showed a clear insect DNA band, indicating that the DNA extraction and PCR amplification were successful. No Wolbachia band was present in this lane, showing that my specimen did not test positive for Wolbachia infection. These results demonstrate that my sample contained amplifiable insect DNA but lacked detectable Wolbachia DNA. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | My BLAST results showed 100% query cover, 100% percent identity, and an E-value of 0.0 for all top matches. Because every metric was 100% and aligned perfectly with Forficula auricularia, my identification is fully confirmed with complete confidence. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
ATTTAAGTTCCGGTCCGTCAAAAGCATAGTGATAGCCCCTGCCAATACTGGCAAAGAAAGCAACAATAAAAGAGCAGTAA TGGCTACGGATCATACAAACAACGGTATTCGTTCCAGCTTAAGGCCCGATGGGCGCATATTAATCACCGTTGTGATAAAA TTAATTGCCCCCAAAATTGATGAAATCCCTGCCAAATGCAATGAAAAAATACTCAAATCTACCGAAGCCCCTGCGTGGGC GATGGCCCCCGACAAAGGGGGGTAAACTGTCCAACCTGTACCAGCTCCTCTATCTACCATACTCCCAGAAAGCAAAAGCA TAAGCGAAGGGGGTAGTAACCAAAAACTCATGTTGTTTATTCGGGGAAAGGCCATATCTGGGGCTCTCAACATCAAAGGT ACCAGTCAATTCCCAAAACCTCCAATCATAATAGGCATTACCATAAAAAAAATCATTACAAAAGCATGGGCCGTAACAAT TACATTATAAATTTGATCATCTCCGATTAAAGCTCCAGGTTGGCCCAATTCTGCCCGAATCAACAAGCTCAATGAAGTCC CCACTATTCCTGATCAAGCCCCAAATACAAAATATAAAGTTCCAATATCTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Forficula auricularia was found to be negative for Wolbachia. |


Wolbachia Project
Alexander Devlin-Myrmica
Brookelynn Foote- Coccinellidae
Maile Bentz- Harmonia axyridis
Madison Adams – Harmonia axyridis