Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 03/05/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | Auburn University at Montgomery |
| Observations | Under a log. Moved very fast. |
| Putative identification | Arthropoda Arachnida Opiliones Sclerosomatidae Leiobunum |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | 1X TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes |
|
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The wolbachia electrophoresis showed positive results for the positive control and one other sample. No results were shown for the negative control or any other samples. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
GTTTGAGCCGCATAGTAGGGTCAGCTCTTAGAATCCTTATTCGCACTGAATTAGGCCAACCAGGGTCTTTAATGAATGACGACCAAATCTATAATGTAGTGGTAACTTCACATGCTTTTGTAATAATCTTTTTTATAGTAATGCCTATTATAATAGGAAGTTTTGGAAATTGATTAGTTCCCTTAATACTAGGAGCGCCAGATATGGCCTTCCCACGTCTAAACAATATAAGATTCTGGCTATTACCCCCATCGTTTGTCCTACTAATTAGATCATCGATAGTAGAAAGAGGTGCAGGTACAGGGTGAACGGTATACCCCCCTCTTTCAAGCAATACTGCCCATAGAGGCCCCTCAGTGGATCTCACTATTTTTTCTTTACACTTAGCAGGTATCTCTTCAATTCTTGGAGCTATCAATTTCATCACAACTGTTATAAACATACGGACAAAGGGTATATTATAC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Leiobunum was found to be negative for Wolbachia. |


North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug
Dark-winged Fungus Gnat