EG2

Sample information

Picture
Entry by: Erica T
Location
Approximate location: 32.36, -86.18
Collection date 03/05/2026
Captive / Cultivated? Wild-caught
Group Auburn University at Montgomery
Observations

Under a log. Moved very fast.

Putative identification Arthropoda Arachnida Opiliones Sclerosomatidae Leiobunum

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniOne
Buffer 1X TBE
DNA stain GelGreen
Gel images
Protocol notes

Taq polymerase used. Annealing temperature for each PCR reaction (55°C). Followed protocol, no mishaps.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

The wolbachia electrophoresis showed positive results for the positive control and one other sample. No results were shown for the negative control or any other samples.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GTTTGAGCCGCATAGTAGGGTCAGCTCTTAGAATCCTTATTCGCACTGAATTAGGCCAACCAGGGTCTTTAATGAATGACGACCAAATCTATAATGTAGTGGTAACTTCACATGCTTTTGTAATAATCTTTTTTATAGTAATGCCTATTATAATAGGAAGTTTTGGAAATTGATTAGTTCCCTTAATACTAGGAGCGCCAGATATGGCCTTCCCACGTCTAAACAATATAAGATTCTGGCTATTACCCCCATCGTTTGTCCTACTAATTAGATCATCGATAGTAGAAAGAGGTGCAGGTACAGGGTGAACGGTATACCCCCCTCTTTCAAGCAATACTGCCCATAGAGGCCCCTCAGTGGATCTCACTATTTTTTCTTTACACTTAGCAGGTATCTCTTCAATTCTTGGAGCTATCAATTTCATCACAACTGTTATAAACATACGGACAAAGGGTATATTATAC
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Leiobunum was found to be negative for Wolbachia.
Report Inappropriate Post