Tetanocera phyllophora

May 3, 2026

Sample information
Picture
Entry by: Ishaaq K.
Location
Collection date 09/02/2025
Captive / Cultivated? Wild-caught
Group Benedictine University
Observations

Collected by Fall 2025 Students
Putative identification Arthropoda Insecta Diptera Sciomyzidae Tetanocera Tetanocera phyllophora

Methods
Extraction kit Qiagen DNeasy Blood and Tissue Kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We conducted DNA extraction, PCR, and gel electrophoresis. Some points of error include the gel electrophoresis controls not working properly and contamination of the DNA as seen through Nanodrop results. In addition, while the Wolbachia DNA was relatively high quality, the COI gene from the arthropod DNA was low quality with values of 20-30. This is why there are no submissions for the “Arthropod” section of this post.

Results
Wolbachia presence Yes
Confidence level Medium
Explanation of confidence level

The Wolbachia band on the gel was very thick. In addition, the BLAST results had a percent identity of 99.10% and an E value of 3e^-167.

The controls did not work as intended. The DNA ladder did not produce any bands. The Wolbachia negative control produced a band for the COI gene and an extra segment of DNA, and the Wolbachia positive control did not produce either the COI gene or Wolbachia DNA. The DNA+ well also did not have a band for arthropod DNA.

The Wolbachia DNA had a high quality sequence, with a general range of 50-60. However, the arthropod DNA had a low quality sequence, with a general range of 20-30.
Wolbachia 16S sequence Download FASTA    Download AB1
TTGGGTTAAGTCCCGCAACGTAGCGCAACCCTCATCCTTAGTTACCATCAGGTAATGCTGGGGACTTTAAGGAAACTGCC CAGTGATAAACTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTGCACACGTGCTACAATG GTGGCTACAATGGGCTGCAAAGTCGCGAGGCTAAGCCAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACT CGAGTGCATGAAGTTGGAATCGCTAGTAATCGTGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCTTGTACACACTG CCCGTCACGCCATGG
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence
Summary The Tetanocera phyllophora was found to be postive for Wolbachia.
Report Inappropriate Post