Sample information |
|
| Picture |
|
|---|---|
| Location | Approximate location: 41.78, -88.10 |
| Collection date | 09/02/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | Collected by Fall 2025 Students |
| Putative identification | Arthropoda Insecta Diptera Sciomyzidae Tetanocera Tetanocera phyllophora |
Methods |
|
| Extraction kit | Qiagen DNeasy Blood and Tissue Kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | We conducted DNA extraction, PCR, and gel electrophoresis. Some points of error include the gel electrophoresis controls not working properly and contamination of the DNA as seen through Nanodrop results. In addition, while the Wolbachia DNA was relatively high quality, the COI gene from the arthropod DNA was low quality with values of 20-30. This is why there are no submissions for the “Arthropod” section of this post. |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | Medium |
| Explanation of confidence level | The Wolbachia band on the gel was very thick. In addition, the BLAST results had a percent identity of 99.10% and an E value of 3e^-167. The controls did not work as intended. The DNA ladder did not produce any bands. The Wolbachia negative control produced a band for the COI gene and an extra segment of DNA, and the Wolbachia positive control did not produce either the COI gene or Wolbachia DNA. The DNA+ well also did not have a band for arthropod DNA. The Wolbachia DNA had a high quality sequence, with a general range of 50-60. However, the arthropod DNA had a low quality sequence, with a general range of 20-30. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
TTGGGTTAAGTCCCGCAACGTAGCGCAACCCTCATCCTTAGTTACCATCAGGTAATGCTGGGGACTTTAAGGAAACTGCC CAGTGATAAACTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTGCACACGTGCTACAATG GTGGCTACAATGGGCTGCAAAGTCGCGAGGCTAAGCCAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACT CGAGTGCATGAAGTTGGAATCGCTAGTAATCGTGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCTTGTACACACTG CCCGTCACGCCATGG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence |
|
| Summary | The Tetanocera phyllophora was found to be postive for Wolbachia. |


Millipede
Brown Widow
(no title)
Texas Carpenter Ant
Boxelder Bug (Hemiptera)