Lasius americanus

Sample information

Picture
Entry by: Evan C
Location
Approximate location: 38.82, -77.18
Collection date 04/17/2026
Captive / Cultivated? Wild-caught
Group Thomas Jefferson High School for Science and Technology
Observations

I found this woodland fuzzy ant underneath a dead wood log that I flipped. Next to this ant were dozens of ant larvae, indicating the existence of a nest nearby. It was during the spring at ten in the morning, and it had just finished raining, thus everything was wet. I located the log next to a river bank and it was roughly 68 degrees F. There were many porthole ants but I took an interest to this one as it seemed like it had wings.

Putative identification Arthropoda Insecta Hymenoptera Formicidae Lasius Lasius americanus

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain SYBR Safe
Gel images
Protocol notes

Gel Image Identification:

571, 572 (lasius americanus), 573, 574, Positive Wolbachia Drosophila, Negative Drosophila, PC DNA, Water, Ladder

The bottom row shared the same samples, but for Wolbachia primers. L to R:

571, 572 (lasius americanus), 573, 574, Ladder, Positive Wolbachia Drosophila, Negative Drosophila Drosophila, PC DNA, Water

Primers to specifically amplify a 438-bp (base pair) fragment of the 16S ribosomal RNA gene (ubiquitous in all Wolbachia) are:
Wolbachia_F (16S_WspecF): 5’−CAT ACC TAT TCG AAG GGA TAG−3’  and
Wolbachia_R (16S_WspecR): 5’−AGC TTC GAG TGA AAC CAA TTC−3’.
When using these primers, the ideal annealing temperature is 55°C.

Primers to specifically amplify a 708-bp fragment of the CO1 cytochrome oxidase gene (ubiquitous in arthropod mitochondria) are:
Arthropod_F (LCO1490): 5’−GGT CAA CAA ATC ATA AAG ATA TTG G−3’  and
Arthropod_R (HCO2198): 5’−TAA ACT TCA GGG TGA CCA AAA AAT CA−3’.
When using these primers, the ideal annealing temperature is 49°C.

Results

Wolbachia presence No
Confidence level Low
Explanation of confidence level

For my group’s Wolbachia gel, our positive drosophila control (which was supposed to show up) did not appear, which made us suspect a false negative error for all the other samples as well.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
NNNNNNNNNTTTGCTATTTGAGCTGGTATAATTGGCTCATCTATAAGAATAATTATCCGA CTAGAATTAGGTTCATCTAATTCATTAATTAATAATGATCAAATTTATAACTCTATAGTT ACAAGGCACGCATTTGTTATAATTTTCTTCATAGTTATACCTTTCATAATTGGTGGATTT GGTAATTTTCTTGTACCTTTAATATTAGGTTCACCTGATATGGCTTACCCCCGTATAAAT AATATAAGATTTTGACTTTTACCTCCCTCTATTTCTCTACTCCTTTTAAGAAATTTCATT AATGATGGAGTCGGAACAGGATGAACCGTTTATCCTCCTTTAGCCTCAAATATCTTCCAT AATGGCCCTTCAGTTGATTTAACTATTTTCTCTCTTCACATCGCTGGAATATCTTCTATT TTAGGAGCTATTAATTTTATTTCAACTATTATAAACATACACCATAAAAATTTTTCTATT GATAAAATTCCACTACTTGTATGATCAATCTTAATTACTGCAATTTTACTACTTCTATCC CTTCCTGTTCTTGCAGGAGCTATTACTATACTTTTAACTGACCGTAACCTTAATACTTCA TTTTTTGACCCATCAGGAGGTGGCGATCCTATTTTATATCAACATCTTTTCTGATTTTTT GNNNN
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lasius americanus was found to be negative for Wolbachia.
Report Inappropriate Post