Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/22/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | Thomas Jefferson High School for Science and Technology |
| Observations | This bug was captured outdoors near Thomas Jefferson High School for Science and Technology in Alexandria, Virginia. It has a large, chunky body and big eyes. For DNA extraction, black slime extracted from the abdomen was used. |
| Putative identification | Arthropoda Insecta Hymenoptera Vespidae Vespula Vespula squamosa |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | SYBR-SAFE |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | My sample seems to have no Wolbachia band, but my group’s controls failed, leading me to have low confidence in saying there is no Wolbachia presence. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AGGAGCTTCTATAAGAATAATTATTCGATTAGAATTAAGATCCCCCGGAGCTTTAATTGGAAATGATCAAATTTATAATACTATTATTACTGCTCATGCATTTGTAATAATTTTTTTTATAGTTATGCCTTTCTTAATGGGAGGATTTGGAAATTGATTAATTCCTTTAATACTGGGAGTTCCAGATATAGCATTTCCTCGAATAAATAATATAAGATTCTGACTTTTACCCCCATCATTATTCCTCTTAATTTTAAGAAATTTTATTGGAACAGGAATGGGAACTGGATGAACTCTTTATCCTCCTCTTTCTTCTATTACTGGCCATGATTCACCACCANTAAATTTAAGAATTTTTTCTATCCATATGGCGG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Vespula squamosa was found to be negative for Wolbachia. |


North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug
Dark-winged Fungus Gnat