Woodland Fuzzy Ant (Lasius Americanus) Annandale/VA 22312

Sample information

Picture
Entry by: Kotravel K.
Location
Collection date 04/22/2026
Captive / Cultivated? Wild-caught
Group Thomas Jefferson High School for Science and Technology
Observations

The ant was found climbing on a tree, between the bark of the tree. The tree was medium size with layered brittle bark with a lot of gaps in between. It was collected during the morning sometime around 9 – 10 am. The weather was very sunny at the time and was a bit humid. I saw other ants as well climbing on other trees but the ants were fast and hard to catch. They would run and hide under the layered bark.

Putative identification Arthropoda Insecta Hymenoptera Formicidae Lasius Lasius americanus

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen/cut:partial
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain SYBR Safe
Gel images
Protocol notes

 

DNA extraction had a 260/280 ration of 1.914 which is just above the sweet spot for good DNA purity which is 1.7-1.9 (preferably right in between at 1.8), meaning DNA is relatively pure. Nucleic acid density was originally 240.843 ng/uL; we had to dilute down to 50 ng/uL before sending it off to sequence.

Results

Wolbachia presence No
Confidence level Low
Explanation of confidence level

In order to test if the sample was Wolbachia positive, a 30 cycle PCR was conducted using SYBR Safe and primers for Wolbachia. The PCR did not indicate a presence/glow for Wolbachia DNA for any of the samples tested. This however also meant that the arthropod sample that was supposed to be positive for Wolbachia that was used as a positive control was also showing no presense/glow for Wolbachia DNA, indicating that something likely went wrong with the process for testing for the Wolbachia specific DNA in the arthropod samples. My group believes that all the PCR steps conducted were generally correct and that that this anomaly was due to us forgetting to add primers into that tube specifically or something else specific to that tube. Do to this lack of confidence, we are unable to guarantee using evidence that Wolbachia was not present in all of our samples.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GCTATTTGAGCTGGTATAATTGGCTCATCTATAAGAATAATTATCCG ACTAGAATTAGGTTCATCTAATTCATTAATTAATAATGATCAAATTTATAACTCTATAGT TACAAGGCACGCATTTGTTATAATTTTCTTCATAGTTATACCTTTCATAATTGGTGGATT TGGTAATTTTCTTGTACCTTTAATATTAGGTTCACCTGATATGGCTTACCCCCGTATAAA TAATATAAGATTTTGACTTTTACCTCCCTCTATTTCTCTACTCCTTTTAAGAAATTTCAT TAATGATGGAGTCGGAACAGGATGAACCGTTTATCCTCCTTTAGCCTCAAATATCTTCCA TAATGGCCCTTCAGTTGATTTAACTATTTTCTCTCTTCACATCGCTGGAATATCTTCTAT TTTAGGAGCTATTAATTTTATTTCAACTATTATAAACATACACCATAAAAATTTTTCTAT TGATAAAATTCCACTACTTGTATGATCAATCTTAATTACTGCAATTTTACTACTTCTATC CCTTCCTGTTCTTGCAGGAGCTATTACTATACTTTTAACTGACCGTAACCTTAATACTTC ATTTTTTGACCCATCAGGAGGTGGCGATCCTATTTTATATCAACATCTTTTCTGATTTTT TGGNCAC
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lasius americanus was found to be negative for Wolbachia.
Report Inappropriate Post