Eastern Calligrapher

June 2, 2026

Sample information
Picture
Entry by: Arjun K
Location
Collection date 04/23/2026
Captive / Cultivated? Wild-caught
Group Thomas Jefferson High School for Science and Technology
Observations
Putative identification Arthropoda Insecta Diptera Syrphidae

Methods
Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer 1X TBE
DNA stain SYBR Safe
Gel images
Protocol notes

Results
Wolbachia presence No
Confidence level High
Explanation of confidence level

The WSpec PCR produced a clear, visible band at approximately 438 bp in Lane 2 on the gel, consistent with the expected Wolbachia-specific amplicon size. The positive control (if run) showed a band at the same position, and the negative control showed no band, confirming the PCR worked correctly and there was no contamination. The CO1 PCR also produced a clear band at approximately 710 bp, confirming successful DNA extraction from the sample. Together, these results strongly support the presence of Wolbachia in this Eastern Calligrapher (Syrphidae) specimen.
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GGAGCTTGAGCTGGATTAGTCGGTACTTCATTAAGTATTTTAATTCGTGCAGAACTTGGTCATCCAGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCTCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCACCTTCATTAACATTATTATTAGTAAGTAGAATAGTTGAAAATGGAGCAGGAACAGGTTGAACAGTTTATCCTCCTCTTTCAGCTAATATTGCTCATAGTGGAGCTTCAGTTGATTTAGCAATTTTTTCACTTCATCTTGCTGGTATATCATCAATTTTAGGAGCAGTAAATTTCATTACTACAGTAATTAATATACGATCAAATGGAATTTCATATGATCGTATACCATTATTTGTTTGATCTGTAGTAATTACAGCACTTTTACTTTTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTTTGATTTTTTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Syrphidae was found to be negative for Wolbachia.
Report Inappropriate Post