Eastern Calligrapher Fly

June 2, 2026

Sample information
Picture
Entry by: Arjun G
Location
Collection date 04/23/2026
Captive / Cultivated? Wild-caught
Group Thomas Jefferson High School for Science and Technology
Observations

Arthropod was captured while at rest on a flower. The location where it was captured was an open field near a stream. No noticeable harm was done to the animal while capturing.
Putative identification Arthropoda Insecta Diptera Syrphidae Toxomerus Toxomerus geminatus

Methods
Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain SYBR Safe
Gel images
Protocol notes

PCR reactions were set up on ice by combining Taq Master Mix, primers, water, and template DNA or controls, and then run in a thermal cycler to amplify arthropod CO1 and Wolbachia genes. A 2% agarose gel was prepared by melting 0.8g agarose in 40mL TBE buffer, adding 4µL SYBR Safe stain, and allowing it to solidify in a casting tray. The gel was placed in an electrophoresis chamber filled with TBE buffer, with the wells facing the negative electrode. Finally, the amplified samples were mixed with loading dye, loaded into the wells alongside a DNA ladder, and run for 15-25 minutes before viewing the DNA bands under blue light.

Results
Wolbachia presence No
Confidence level High
Explanation of confidence level

The gel testing for the arthropod COI gene showed a bright, clear band, confirming a highly successful DNA extraction using the DNeasy kit. However, the other gel testing for the 16S Wolbachia gene did not display any band in the corresponding lane for this specimen, providing visual evidence of a negative result.
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
AGCTTGAGCTGGATTAGTCGGTACTTCATTAAGTATTTTAATTCGTGCAGAACTTGGTCATCCAGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCACCTTCATTAACATTATTATTAGTAAGTAGAATAGTTGAAAATGGAGCAGGAACAGGTTGAACAGTTTATCCTCCTCTTTCAGCTAATATTGCTCATAGTGGAGCTTCAGTTGATTTAGCAATTTTTTCACTTCATCTTGCTGGTATATCATCAATTTTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGATCAAATGGAATTTCATATGATCGTATACCATTATTTGTTTGATCTGTAGTAATTACAGCACTTTTACTTTTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTTTGATTTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Toxomerus geminatus was found to be negative for Wolbachia.
Report Inappropriate Post