Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/23/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | Thomas Jefferson High School for Science and Technology |
| Observations | Arthropod was captured while at rest on a flower. The location where it was captured was an open field near a stream. No noticeable harm was done to the animal while capturing. |
| Putative identification | Arthropoda Insecta Diptera Syrphidae Toxomerus Toxomerus geminatus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | PCR reactions were set up on ice by combining Taq Master Mix, primers, water, and template DNA or controls, and then run in a thermal cycler to amplify arthropod CO1 and Wolbachia genes. A 2% agarose gel was prepared by melting 0.8g agarose in 40mL TBE buffer, adding 4µL SYBR Safe stain, and allowing it to solidify in a casting tray. The gel was placed in an electrophoresis chamber filled with TBE buffer, with the wells facing the negative electrode. Finally, the amplified samples were mixed with loading dye, loaded into the wells alongside a DNA ladder, and run for 15-25 minutes before viewing the DNA bands under blue light. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The gel testing for the arthropod COI gene showed a bright, clear band, confirming a highly successful DNA extraction using the DNeasy kit. However, the other gel testing for the 16S Wolbachia gene did not display any band in the corresponding lane for this specimen, providing visual evidence of a negative result. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AGCTTGAGCTGGATTAGTCGGTACTTCATTAAGTATTTTAATTCGTGCAGAACTTGGTCATCCAGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCACCTTCATTAACATTATTATTAGTAAGTAGAATAGTTGAAAATGGAGCAGGAACAGGTTGAACAGTTTATCCTCCTCTTTCAGCTAATATTGCTCATAGTGGAGCTTCAGTTGATTTAGCAATTTTTTCACTTCATCTTGCTGGTATATCATCAATTTTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGATCAAATGGAATTTCATATGATCGTATACCATTATTTGTTTGATCTGTAGTAATTACAGCACTTTTACTTTTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTTTGATTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Toxomerus geminatus was found to be negative for Wolbachia. |


Subfamily Pentatominae
Eastern boxelder (Boisea trivittata)
(no title)
Subclass Pterygota (Winged and Once-winged insects)
(no title)