Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/23/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | Thomas Jefferson High School for Science and Technology |
| Observations | Arthropod was captured while resting on a flower. It was captured in a field near a stream. During the capture no harm was done to the animal. |
| Putative identification | Arthropoda Insecta Diptera Syrphidae Toxomerus Toxomerus geminatus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniPCR |
| Buffer | TBE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | To amplify arthropod CO1 and Wolbachia genes, PCR reactions were set up on ice using Taq Master Mix, primers, water, template DNA, or controls. The reactions were then conducted in a thermal cycler. Melting 0.8g of agarose in 40mL of TBE buffer, adding 4µL of SYBR Safe dye, and letting it solidify on a casting tray resulted in a 2% agarose gel. The gel was put in an electrophoresis chamber with the wells facing the negative electrode and filled with TBE buffer. In order to see the DNA bands under blue light, the amplified samples were finally combined with loading dye, loaded into the wells next to a DNA ladder, and ran for 15 to 25 minutes. |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | High |
| Explanation of confidence level | An extremely successful DNA extraction using the DNeasy kit was confirmed by the strong, clear band seen in the arthropod COI gene gel test. Strong visual proof of a positive result was provided by the other gel test for the 16S Wolbachia gene, which similarly showed a clear, bright band in the relevant lane for this specimen. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AGCTTGAGCTGGATTAGTCGGTACTTCATTAAGTATTTTAATTCGTGCAGAACTTGGTCATCCAGGAGCATTAATTGGAGATGATCAAATTTATAATGTAATTGTAACTGCTCATGCATTTGTAATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCATTAATATTAGGAGCCCCTGATATAGCATTTCCTCGAATAAATAATATAAGATTTTGATTATTACCACCTTCATTAACATTATTATTAGTAAGTAGAATAGTTGAAAATGGAGCAGGAACAGGTTGAACAGTTTATCCTCCTCTTTCAGCTAATATTGCTCATAGTGGAGCTTCAGTTGATTTAGCAATTTTTTCACTTCATCTTGCTGGTATATCATCAATTTTAGGAGCAGTAAATTTTATTACTACAGTAATTAATATACGATCAAATGGAATTTCATATGATCGTATACCATTATTTGTTTGATCTGTAGTAATTACAGCACTTTTACTTTTATTATCATTACCAGTTTTAGCAGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTTTTTGATCCTGCTGGAGGAGGAGATCCAATTTTATACCAACATTTATTTTGATTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Toxomerus geminatus was found to be postive for Wolbachia. |


North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug
Dark-winged Fungus Gnat