Sample information |
|
| Picture |
|
|---|---|
| Location | No map location data available. |
| Collection date | 09/10/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | Penn State Lehigh Valley |
| Observations | Spotted body and wings, Red abdomen, pointed ended tail |
| Putative identification | Arthropoda Insecta Hemiptera |
Methods |
|
| Extraction kit | Qiagen DNeasy Blood and Tissue Kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Lane 1- DNA Standard Lane 2- HOBG1 (WOL +CO1) Lane 3- HOBG2 (WOL+CO1) Lane 4- EBCP (WOL +CO1) Lane 5- Positive Control (WOL +CO1) Lane 6- Negative Control (WOL +CO1) Lane 7- gDNA control (WOL +CO1) Lane 8- water (WOL +CO1)
|
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | In the Gel image in well 3 is my sample which I can clearly see a band higher up clearly indicating for the CO1, however I don’t see any bands lower so Wolbachia is not present in my sample. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
ATTCGAATATGAATTANCAGGACCGGGNNCATGATTATGGAGNGATCAAATATATTATGTACTTGTTACTGCTCCTGCTT TCATTATAATTTTTTTTATANTTATACCAATTATAATTGGTGGGTTCGGTAATTGATTATTACCATTAATAATTGGGGCA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Hemiptera was found to be negative for Wolbachia. |
ABRHS 2026 – Ant – 12-3 Synemosyna Formica
ZETNJM Hymenoptera
CON-SCA Hemiptera
CONDJ Hemiptera