Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/27/2021 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | Lanternfly has black spots on its wings (looks like ink spatters); ends of wings have small, black pinpricks on its wings; folded black legs; black body; abdomen is shiny and black-and-white striped; underside of wings is darkish but bright red; small, black head The lanterfly was found by another student (not myself) outside of my school doors on the pavement. The bug was found in early fall and the temperature was 21.1º C. |
| Putative identification | Arthropoda Insecta Hemiptera Fulgoridae Lycorma Lycorma delicatula |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | DNA extraction: I dissected the lanternfly’s abdomen, extracted its dna, and macerated it (excluding exoskeleton). Unfortunately, I did not macerate the abdomen extract for long enough in the cell lysis buffer, resulting in a lower concentration of DNA. Gel electrophoresis lanes are as follows:
Analysis: No controls were used in this experiment due time restrictions. Faint bands are present at the arthropod and wolbachia bp location. Sequencing: Both arthropod and wolbachia samples from my bug were sequenced, but both had very low quality (overall Q value was 19). Nonetheless, when I “blastn” and “blastx” the sequences, they matched to the corresponding arthropod and a wolbachia dna. |
Results |
|
| Wolbachia presence | Yes |
| Confidence level | High |
| Explanation of confidence level | Despite the faint wolbachia band on the gel electrophoresis for my ant and the low-quality wolbachia sequence, I am highly confident that my bug has wolbachia because the blastn and blastx results demonstrated that I did in fact extract wolbachia dna from my lanternfly. I don’t have controls to compare my gel electrophoresis results to, but like I said, the blastn and blastx results make me confident in my results. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
NNNNNNTNNTNNNNNNNNNNTGNNGCNTGNCAGTCNNACCTCNTGTCAAGAAATGTTGGGATANGTCCCGCAACAACCGC GACCCTCATCCTTAGTTACCATCAGGTAATGCTGGGGACTTTAAGGAGACTGCCATTGATAAACTGGAGGAAGGTGGGGA TGATGTCAAGTCATCATGGCCCTTATGGAGTGGGCTACCCACGTGCTACAATGGTGGCTACAATGGGCTGCAAAGTCGCG AGGCTAAGCCAATCCCTTAAAAGCCATCTCAGTTCGGATTGTACTCTGCAACTCAAGTGCTTGAAGTTGGAATCGCTAAT AGTCGTGGATCAGCACGCCACGGTGAATACGTTCTCGGGTCTTGTACACACTGCCCGGCACGCCATGGGAATTGTTTTCA CTCGAAGCTAAGGATTAAGATCNNNNAATTTNNANNTTCAATTATTNCNACACAAATAAATATNCNAACAGAAATAATTA TAAAAATATTTTTCCTTTCCTGCTGTATGACATTAATTGTATTCCCATTATCANTACCNTTTTACCACGAGCGNNNCAGA ATTATATATATTTNTTTNATCTGATNNATAATTCTTTACNNTTTNNGNCGGNNGAGGGGGGAGGNNCCNNNTCTTTNAAC ATCTATTCTTNTTTTTTTTTGNCCCCCANGANNANAAAAAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence | Download FASTA
Download AB1
NNNNNNNNNTNNNTNNNGGGTATGATGNNNACTANTNGGNACGNNAGAAGAATAATNATTCGAATAGAATTANNACAANC AGGATCAATTATTAGGAATGACCAAATCTATAAAACCATCGGTACCTCTCCTGGATTCATTATTGATTTCTTTATAGNNA TACCTATTATAATTGGAGGATTTGGAAACTGATTAGTTCCTATAATTTTTGGGGCCCCCTACATGGCATTCCCACGAATA AATAATATAANATTTTGATTACTACCNCCATCAATTTCACTTTTAATTGCAAGATCAATCGGAGGGACAGGATCAGGTAC AGGATGAACTGTTTACCCCCCTCTCTCCCCCCAAATTGCCCTTTCAGGACCTTCANTAGACCTAACTATTTTTTCACTTC NCTTCGCAGGTTTAAGATCANTCNTAGGAGCAATCAATTTCATTTCNACAACAATAAATATACGGCCAAAAGGAATAACT ATAGAAAAAATACCCCTTTTCTGTTGATCANTCCTAATTACAGCAGATTTACTACTAGTATCATTACCAGTACTAGCTGG AGCAATTACAATACTACTAACAGATCNAAACTTNAANACCNCNTTTTTTGACCCCNCGGNNGGAGGAGANCNNNTTTTAT ATCAACACTTATTCTGATTTTTTGGTCNCCCNGAAGATNAANAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Lycorma delicatula was found to be postive for Wolbachia. |


Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera
Cisseps Fulvicollis