Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/13/2022 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | In a spider’s mouth, on the forest floor |
| Putative identification | Arthropoda Insecta Diptera Calliphoridae Lucilia Lucilia sericata |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | PCR-test: band at cytochrome oxidase |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
ATTATAATTGGAGGATTCGGAAATTGATTAGTTCCTTTAATACTAGGAGCTCCAGATATGGCTTTTCCTCGAATAAACAATATAAGTTTTTGACTTTTACCCCCAGCTTTAACTCTACTCC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Lucilia sericata was found to be negative for Wolbachia. |


Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)
JTR 1