Coenosia tigrina JR2

October 26, 2022

Sample information
Picture
Photos by: JR
Location
Collection date 09/13/2022
Captive / Cultivated? Wild-caught
Group KantiWil
Observations

In a spider’s mouth, on the forest floor
Putative identification Arthropoda Hexapoda Insecta Diptera Calliphoridae Lucilia Lucilia sericata

Methods
Extraction kit Instagene Matrix
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Results
Wolbachia presence No
Confidence level High
Explanation of confidence level

PCR-test: band at cytochrome oxidase
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
ATTATAATTGGAGGATTCGGAAATTGATTAGTTCCTTTAATACTAGGAGCTCCAGATATGGCTTTTCCTCGAATAAACAATATAAGTTTTTGACTTTTACCCCCAGCTTTAACTCTACTCC
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lucilia sericata was found to be negative for Wolbachia.
Report Inappropriate Post