Sample information |
|
Picture |
![]() |
---|---|
Location | |
Collection date | 09/14/2022 |
Captive / Cultivated? | Wild-caught |
Group | KantiWil |
Observations | on forestground under leaves and other plants |
Putative identification | Hexapoda Insecta Hymenoptera Formicidae |
Methods |
|
Extraction kit | Instagene Matrix |
DNA extraction location | Whole arthropod |
Single or Duplex PCR | Duplex Reaction |
Gel electrophoresis system | Standard electrophoresis system |
Buffer | TAE |
DNA stain | Fast Blast |
Gel images |
![]() |
Protocol notes | |
Results |
|
Wolbachia presence | No |
Confidence level | Low |
Explanation of confidence level | Banden im Gel nur schwach erkennbar |
Wolbachia 16S sequence | |
Arthropod COI sequence | Download FASTA
Download AB1
ACCCATTAATTAATAATGATCAAATTWATAATTCTCTTGTAACTAGCCATGCCTTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGGGGCTTTGGTAATTTTTTAATTCCTTTAATATTAG
BLAST at The Wolbachia Project BLAST at NCBI
|
Summary | The Formicidae was found to be negative for Wolbachia. |