Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/14/2022 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | on forestground under leaves and other plants |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | Fast Blast |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | Low |
| Explanation of confidence level | Banden im Gel nur schwach erkennbar |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
ACCCATTAATTAATAATGATCAAATTWATAATTCTCTTGTAACTAGCCATGCCTTTATTATAATTTTTTTTATAGTTATACCATTTATAATTGGGGGCTTTGGTAATTTTTTAATTCCTTTAATATTAG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Formicidae was found to be negative for Wolbachia. |


Wolbachia Project
Alexander Devlin-Myrmica
Brookelynn Foote- Coccinellidae
Maile Bentz- Harmonia axyridis
Madison Adams – Harmonia axyridis