Sample information |
|
Picture |
|
---|---|
Location | |
Collection date | 09/13/2022 |
Captive / Cultivated? | Captive / Cultivated |
Group | KantiWil |
Observations | By the stone legs of a bench on the side. |
Putative identification | |
Methods |
|
Extraction kit | Instagene Matrix |
DNA extraction location | Abdomen |
Single or Duplex PCR | Duplex Reaction |
Gel electrophoresis system | Standard electrophoresis system |
Buffer | TAE |
DNA stain | SYBR Safe |
Gel images |
|
Protocol notes | |
Results |
|
Wolbachia presence | No |
Confidence level | Low |
Explanation of confidence level | There was no anthropod DNA detected, although spiders are anthropods. Therefore the confidence level of the spider being Wolbachia negative is low. |
Wolbachia 16S sequence | Download FASTA
Download AB1
TGCTATAAGAGTATTGATTCGTATTGAATTGGGGCAATCTGGAAGATTGCTGGGGGATGATCAATTGTATAATGTTATTG TTACTGCGCATGCTTTTGTAATAATCTTTTTTATAGTTAT
BLAST at The Wolbachia Project BLAST at NCBI
|
Arthropod COI sequence |
|
Summary |