Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/13/2022 |
| Captive / Cultivated? | Captive / Cultivated |
| Group | KantiWil |
| Observations | By the stone legs of a bench on the side. |
| Putative identification | |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | Low |
| Explanation of confidence level | There was no anthropod DNA detected, although spiders are anthropods. Therefore the confidence level of the spider being Wolbachia negative is low. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
TGCTATAAGAGTATTGATTCGTATTGAATTGGGGCAATCTGGAAGATTGCTGGGGGATGATCAATTGTATAATGTTATTG TTACTGCGCATGCTTTTGTAATAATCTTTTTTATAGTTAT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence |
|
| Summary | |


Grasshopper, student Wolbachia project
Wolbachia Project (Bombus Terrestris)
Vespula
Bombus Affinus (Rusty Patch Bumblebee)
European Earwig