GRE-ACF-SP23 #12 Coleoptera

Sample information

Picture
Photos by: Christine Agostini
Location
Collection date 01/25/2023
Captive / Cultivated? Wild-caught
Group Georgia Southern University
Observations
1/25/23
Ladybugs
2:09pm
Cloudy and wet
In front of Science Center
On the tea olive tree
Beating net
Putative identification Hexapoda Insecta Coleoptera

Methods

Extraction kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system
Buffer TAE
DNA stain Other
Gel images
Protocol notes

DNA extraction kit of in-house reagents was used

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

Are PCR experiment was a success so we are confident with the results.

Wolbachia 16S sequence
Arthropod COI sequence
GTAGGAACATCGTTAAGTATTTTAATTCGGTTAGAAttacgatctAgagGAAGATTAATTGGAAA CGACCAAATTTATAAtactattGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATAC CTATTATAATTGGGGGTTTTGGAAATTGAtTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCA TTTCCACGATTAAATAACATAAGATTTTGACTTTTACCCCCTGCTTTAACTCTTTTAATTTTAAG AACAATCGTAGAAATAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTCTTTCTTCTAATTTAA CACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATT TTAGGTGCAGTAAATTTCATttcaaCTATTATAAATATACGTCCATTTGGT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Coleoptera was found to be negative for Wolbachia.
Report Inappropriate Post