Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/18/2023 |
| Captive / Cultivated? | Wild-caught |
| Group | Edmund Burke School |
| Observations | This cricket is brown on top with a light beige underbelly. Long antennae. Little to differentiate torso from abdomen. |
| Putative identification | Arthropoda Insecta |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Partial abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | DNA EXTRACTION It was hard to divide up the abdomen as it all kind of turned to goop, so we scooped up what we could and added it to the vial. MISTAKES We didn’t make any mistakes during the arthropod electrophoresis, but something went wrong for our wolbachia electrophoresis the first time we did it. Luckily, we repeated the experiment and all looks to have gone well. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | We did make a mistake the first time we did our wolbachia electrophoresis, but we paid extra attention the next time, and everything looked to have gone perfectly well. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
AGTCGGCACATCACTAAGTATTTTAATTCGAACGGAATTAGGACAACCAGGGTATCTTATTGGAGATGATCAAACATATA ATGTAATTGTTACTGCACACGCCTTTATTATAATTTTCTTCATAGTAATACCAATTATGATTGGAGGATTCGGAAATTGA TTAGTTCCCTTAATATTAGGAGCACCCGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCCCCTTC ATTAACTCTCCTATTAACCAGAAGAATAGTTGAAAATGGAGCAGGTACAGGATGAACAGTTTATCCACCCTTGTCAACAG GAATTGCCCATGCAGGAGCATCAGTTGATTTAGCAATTTTCTCATTACATCTCGCCGGAATCTCCTCCATTTTAGGTGCT GTAAATTTTATTACTACCATAATTAATATACGAGCTCCTAGAATGTCTTTAGATCAAACACCCCTATTTGTGTGAGCAGT AGGAATTACAGCACTATTATTATTATTATCATTACCTGTACTAGCAGGAGCTATTACTATACTATTAACTGATCGAAACT TAAATACCTCATTTTTTGATCCCGCAGGA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Insecta was found to be negative for Wolbachia. |





Blattodea LB2
tenebrio molitor_To1
JC2
YSD2