Wolbachia-negative species in genus Tegenaria

Sample information

Picture
Photos by: Zachary L.
Location
Collection date 04/01/2025
Captive / Cultivated? Wild-caught
Group College of Eastern Idaho
Observations

Caught alive in a suburban environment, isolated from its web.

Putative identification Arthropoda Arachnida Araneae Agelenidae Tegenaria

Methods

Extraction kit Edwards Buffer
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain GelGreen
Gel images
Protocol notes

TheĀ Tegenaria tests are located in the bottom gel, rightmost column, third and seventh rows (WspecF and CO1, respectively). The shakiness of the bars in the Gel EP suggests imperfections in the gel structure, most likely during formation.

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

The ab1 file for the arthropod sample CO1 shows contamination, if only a small amount, suggesting that contamination occurred either during predation or in a miniscule amount during extraction purification. Furthermore, since no controls were used, I can only be somewhat confident in my results.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
AAAGTGATGATTCTAATTGAATTGGGTCAGTTGGGGAGATTTATTGGAGATGATCATTTATATAATGTAATTGTTACGGCTCACGCTTTTGTTATGATTTTTTTTATAGTGATACCTATTATAATTGGTGGGTTTGGAAATTGATTGGTTCCTTTAATATTAAGGGCTCCGGATATGGCTTTTCCTCGAATGAATAATTTGAGATTTTGATTGTTGCCTCCTTCGTTATTTATGCTTTTTATTTCTTCTATGGTGGATATAGGGGTTGGTGCTGGTTGAACAATTTATCCTCCTTTGGCTTCTTCTATGGGACATATAGGGAGAGCTATAGATTTTGCTATTTTTTCTTTGCATTTAGCAGGGGCGTCTTCTATTATGGGAGCGGTGAATTTTATTACTACGATTTTAAATATACGTTCTGTAGGGATAAGAATAGATAGGGTTTCTTTGTTTGTTTGGTCGGTATTGGTTACCGCTATTTTATTGTTATTGTCTTTGCCTGTATTAGCGGGTGCTATTACGATATTGTTGACGGATCGAAATTTTAATACATCATTTTTTGATCCTGCAGGTGGAGGGGATCCGATTTTATTTCAACACTTGTTTTGATTTTTTGGTCACCCTGAA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Tegenaria was found to be negative for Wolbachia.
Report Inappropriate Post