Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/01/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | College of Eastern Idaho |
| Observations | Caught alive in a suburban environment, isolated from its web. |
| Putative identification | Arthropoda Arachnida Araneae Agelenidae Tegenaria |
Methods |
|
| Extraction kit | Edwards Buffer |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | TheĀ Tegenaria tests are located in the bottom gel, rightmost column, third and seventh rows (WspecF and CO1, respectively). The shakiness of the bars in the Gel EP suggests imperfections in the gel structure, most likely during formation. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | The ab1 file for the arthropod sample CO1 shows contamination, if only a small amount, suggesting that contamination occurred either during predation or in a miniscule amount during extraction purification. Furthermore, since no controls were used, I can only be somewhat confident in my results. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AAAGTGATGATTCTAATTGAATTGGGTCAGTTGGGGAGATTTATTGGAGATGATCATTTATATAATGTAATTGTTACGGCTCACGCTTTTGTTATGATTTTTTTTATAGTGATACCTATTATAATTGGTGGGTTTGGAAATTGATTGGTTCCTTTAATATTAAGGGCTCCGGATATGGCTTTTCCTCGAATGAATAATTTGAGATTTTGATTGTTGCCTCCTTCGTTATTTATGCTTTTTATTTCTTCTATGGTGGATATAGGGGTTGGTGCTGGTTGAACAATTTATCCTCCTTTGGCTTCTTCTATGGGACATATAGGGAGAGCTATAGATTTTGCTATTTTTTCTTTGCATTTAGCAGGGGCGTCTTCTATTATGGGAGCGGTGAATTTTATTACTACGATTTTAAATATACGTTCTGTAGGGATAAGAATAGATAGGGTTTCTTTGTTTGTTTGGTCGGTATTGGTTACCGCTATTTTATTGTTATTGTCTTTGCCTGTATTAGCGGGTGCTATTACGATATTGTTGACGGATCGAAATTTTAATACATCATTTTTTGATCCTGCAGGTGGAGGGGATCCGATTTTATTTCAACACTTGTTTTGATTTTTTGGTCACCCTGAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Tegenaria was found to be negative for Wolbachia. |


Formica Pallidefulva
Formica Pallidefulva
Ant
Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft