Drymus crassus

Sample information

Picture
Entry by: Max L.
Location
Approximate location: 40.62, -74.57
Collection date 05/30/2025
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

The bug is terrestrial and was found on the ground in a wooded area. It is tiny, around 3-5mm, and appears to be the larval stage of Drymus crassus. The upper half of the specimen is black, with the lower half of the body being red with small black spots running down the spine.

Putative identification Arthropoda Insecta Hemiptera Rhyparochromidae Drymus Drymus crassus

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Extract the DNA using the Qiagen DNeasy extraction kit, and then amplify both Wolbachia and arthropod COI genes using PCR. After completing PCR, the 2% gel was run using SYBR Safe using a 100bp ladder. In lane 8 of the gel, the sample had a strong band that lined up with the positive Wolbachia control in lane 9, which strongly suggests Wolbachia presence. The PCR sample was then purified using the QIAquick PCR Purification Kit and sent out for sequencing.

Results

Wolbachia presence Yes
Confidence level High
Explanation of confidence level

There is a visible band for the PCR sample using Wolbachia primers in the gel in lane 8, which lines up with the positive Wolbachia control in lane 9. The positive Wolbachia control was an arthropod confirmed to have been infected with Wolbachia, which underwent the same DNA extraction and PCR process as the sample. After sending the sample out for sequencing, the sequence for the Wolbachia PCR sample was a 99.72% match, with the Sanger sequencing data having high quality (~60).

The Wolbachia sequence had one nucleotide of relatively low quality (16) and was replaced with an N. This nucleotide was a T, and if it were left included would produce 100% matches with Wolbachia.

Wolbachia 16S sequence Download FASTA    Download AB1
GCTCGTGTCGTGAGANGTTGGGTTAAGTCCCGCAACGAGCGCAACCCTCATCCTTAGTTGCTATCAGGTAATGCTGAGTA CTTTAAGGAAACTGCCAGTGATAAGCTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCTTTATGGAGTGGGCTAC ACACGTGCTACAATGGTGTCTACAATGGGCTGCAAGGTGCGCAAGCCTAAGCTAATCCCTAAAAGACATCTCAGTTCGGA TTGTACTCTGCAACTCGAGTACATGAAGTTGGAATCGCTAGTAATCGTGGATCAGCATGCCACGGTGAATACGTTCTCGG GTCTTGTACACACTGCCCGTCACGCCATGGGAATTGG
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence Download FASTA    Download AB1
TCATTAAGATGAATTATCCGAATTGAATTAGGACAACCTGGACCATTCATTGAAGACGATCAAATTTATAATACCATTGT AACAGCACACGCATTTATTATAATTTTCTTTATAGTTATACCAATTATAATTGGAGGATTTGGTAACTGATTAGTACCAT TAATAATTGGGGCCCCAGATATAGCATTCCCACGAATAAATAATATAAGATTCTGACTACTCCCACCATCAATCACACTA TTAATCATAAGAAGAATAATCGAAATAGGAGTAGGAACCGGATGAACAGTATATCCTCCTCTATCAAATAACATATTTCA TAGAGGAGCAGCAGTAGATATAGCAATCTTTTCACTACATTTAGCAGGAATATCATCAATTATAGGAGCCATTAATTTCA TCTCAACTATCATTAACATACGACCTACAGGAATAGTACCAGAACAAATTCCTCTATTCGTATGATCAGTAGGAATCACA GCAGTCCTATTATTATTATCATTACCAGTATTGGCCGGAGCAATCACTATACTATTAACAGACCGAAACCTAAATACATC CTTCTTTGACCCTACAGGAGGAGGAGACCCAATTTTATACCAACACTTATTTTGATTTTTTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Drymus crassus was found to be postive for Wolbachia.
Report Inappropriate Post