Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/24/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | California Academy of Mathematics and Science |
| Observations | Caught outside classroom around 9:00 am near some bushes. There were many more ants present in the same area. |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Linepithema Linepithema humile |
Methods |
|
| Extraction kit | Edwards Buffer |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | agarose gel electrophoresis |
| Buffer | 1X TAE |
| DNA stain | UView |
| Gel images |
|
| Protocol notes | DNA Stain We used a UV stain and let it stain for the duration of our gel electrophoresis run. Gel Electrophoresis 10 microliters of sample were added per well for this 1% agarose gel. This is the lane order for the gel: 1. DNA Ladder 2. Positive Control 3. Positive DNA Control 4. Negative Control 5. Ant Sample 1 6. Ant Sample 2 – This one 7. Ant Sample 3 8. Water |
Results |
|
| Wolbachia presence | Unknown |
| Confidence level | High |
| Explanation of confidence level | We present high confidence in the fact that we don’t know if Wolbachia was present or not as there was a distinct band present in the negative control lane for the arthropod-specific gene and nothing for the Wolbachia. This lets us know that there was a mishap that occurred during the execution of our procedure, so we cannot draw any conclusions confidently. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
NNNNNNNNNNNNNNNNAGNNNNNNNGNNTGCNCNNCTCTTGTCTNGATATNTTTTGTTATTTCTTTTTCGAGCGCCCCCT NNTCCATANTTACCATCAAGTAATGCTGGGGACTTTAAGGAAACTGCCAGTGATAAACTGGAGGAAGGTGGGGATGATGT CAAGTCATCTTGGCCCTTATGGAGTGGGCTACACACGTGCTACAATGGTGGCTACAATGGGCTGCAAAGTCGCGAGGCTA ANCTAATCCCTTAAAACCCATCTCANTTCGGATTGTACTCTGCAACTCNAGTGCATGAAGTTGGAATCGCTAGTAATCCT GGATCANCACGCCACGGTGAATACGTTCTCGGGTCTTGTACCCACTGCCCGTCTCGCCATGGGAATTGGTTTCCCTCNAA GCTANNN
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence |
|
| Summary | |


North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug
Dark-winged Fungus Gnat