Lasius alienus

Sample information

Picture
Entry by: Daniil P
Location
Approximate location: 38.82, -77.17
Collection date 04/22/2026
Captive / Cultivated? Wild-caught
Group Thomas Jefferson High School for Science and Technology
Observations

Organism was collected from an ant nest under an unearthed log in April. Many ants were nearby, multiple were extracted, then this sample was randomly selected. Organism was small, so full organism was processed.

Putative identification Arthropoda Insecta Hymenoptera Formicidae Lasius Lasius alienus

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer 1X TBE
DNA stain SYBR Safe
Gel images
Protocol notes

DNA extraction: whole arthropod was crushed thoroughly with a pestle until fully solvent. Exoskeleton was negligible due to size.

Gel electrophoresis lanes, top (CO1):

1 – empty

2 – other sample

3 – other sample

4 – other sample

5 – Lasius alienus sample

6 – Positive drosophila control

7 – Negative drosophila control

8 – Positive DNA control

9 – water

10 – 1kB ladder

Gel electrophoresis lanes, bottom (qPCR for wolbachia 16S rRNA gene)  :

1 – empty

2 – other sample

3 – other sample

4 – other sample

5 – Lasius alienus sample

6 – 1kB ladder

7 – Positive drosophila control

8 – Negative drosophila control

9 – Positive DNA control

10 – water

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

Although the Wolbachia-positive DNA control showed a band for the 16s rRNA Wolbachia gene and CO1, the positive control drosophila only showed a band for CO1.

This could have resulted from a variety of errors. First, the positive control may not have actually been positive. Second, the DNA extraction could have recovered the host DNA successfully but very little bacterial DNA. Third, some PCR inhibitors could have wiped out Wolbachia DNA while the more abundant CO1 DNA remained. Fourth, Wolbachia titer may be too low in that fly DNA prep.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GCTATTTGAGCTGGTATAATTGGCTCATCTATAAGAATAATTATCCGACTAGAATTAGGTTCATCTAATTCATTAATTAATAATGATCAAATTTATAACTCTATAGTTACAAGGCACGCATTTGTTATAATTTTCTTCATAGTTATACCTTTCATAATTGGTGGATTTGGTAATTTTCTTGTACCTTTAATATTAGGTTCACCTGATATGGCTTACCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCCTCTATTTCTCTACTCCTTTTAAGAAATTTCATTAATGATGGAGTCGGAACAGGATGAACCGTTTATCCTCCTTTAGCCTCAAATATCTTCCATAATGGCCCTTCAGTTGATTTAACTATTTTCTCTCTTCACATCGCTGGAATATCTTCTATTTTAGGAGCTATTAATTTTATTTCAACTATTATAAACATACACCATAAAAATTTTTCTATTGATAAAATTCCACTACTTGTATGATCAATCTTAATTACTGCAATTTTACTACTTCTATCCCTTCCTGTTCTTGCAGGAGCTATTACTATACTTTTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCATCAGGAGGTGGCGATCCTATTTTATATCAACATCTTTTCTGATTTTTTGGNCAC
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lasius alienus was found to be negative for Wolbachia.
Report Inappropriate Post