Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/25/2026 |
| Captive / Cultivated? | Wild-caught |
| Group | Pingry School |
| Observations | Caught with tweezers on a hiking trail on the Pingry School Basking Ridge campus, flying low and landing on the ground. The ground was decently wet, having just rained a day ago. |
| Putative identification | Arthropoda Insecta Diptera Asilidae Eudioctria Eudioctria albius |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | agarose gel electrophoresis |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | Specimen 1 was collected and its DNA extracted using the DNeasy protocol. Two PCR reactions were run on the extracted DNA. The first used COI primers to amplify a region of the arthropod cytochrome oxidase I gene (~708 bp), confirming that intact arthropod DNA was present. The second used Wolbachia primers (~438 bp) to test for the bacteria. Each reaction included a positive control and a water negative control. Products were run on an 1% agarose gel (100V) with a 100bp DNA ladder and visualized under UV to compare band sizes against the controls. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | In the gel, the COI and Wolbachia samples were loaded into the top and bottom wells, respectively. The COI reaction in lane 2 produced a band at ~708 bp matching the positive control, confirming the extracted arthropod DNA was present. The positive control amplified cleanly at ~438 bp for Wolbachia (proving the primers and reaction worked), and the water negative control stayed clear (ruling out contamination). Knowing the PCR reaction worked, we know the absence of a band on the bottom well for lane 2 is a negative for Wolbachia. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AATTCGAACTGAACTTGGCCACCCTGGATCTCTTATTGGAGATGACCAAATTTATAATGTAATTGTTACAGCCCACGCAT TTGTTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTCGGAAATTGATTAGTTCCCTTAATATTAGGAGCC CCTGATATAGCATTCCCACGAATAAATAACATAAGATTTTGACTATTGCCTCCGTCTCTTACTCTTCTACTCGCTAGTAG TATAGTTGAAAATGGAGCTGGAACAGGATGAACAGTATACCCCCCTCTTTCATCAAGAATTGCCCATAGAGGATCGTCTG TTGACTTAGCAATTTTTTCTCTTCACCTTGCCGGAATCTCGTCAATTTTAGGGGCAGTTAATTTTATTACTACCATTATT AATATACGATCAATTGGAATCACATTTGACCGTATACCCCTATTTGTTTGATCAGTTATAATCACTGCAATTCTTCTATT ACTATCATTACCAGTATTAGCAGGAGCTATTACAATATTATTAACTGACCGAAATTTAAACACTTCTTTCTTTGACCCTG CAGGAGGTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Eudioctria albius was found to be negative for Wolbachia. |


The fANTastical four
Pepsinae (Spider Wasp, Wolbachia +)
Camponotus nearcticus (Wolbachia +)
Colonus sylvanus (Sylvan Jumping Spider, Wolbachia +)