Bald-faced Hornet

Sample information

Picture
Entry by: Kanchan D.
Location
Collection date 04/20/2026
Captive / Cultivated? Wild-caught
Group Thomas Jefferson High School for Science and Technology
Observations

The specimen was a yellowjacket wasp with a mostly black body, bright yellow markings on the abdomen, and yellow patches on the thorax. Its wings were narrow and translucent with a brownish tint. The legs appeared dark with lighter yellow areas near the joints. The specimen was wild-caught outdoors and was intact enough for the body markings to be clearly observed under magnification.

Putative identification Arthropoda Insecta Hymenoptera

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniPCR
Buffer TBE
DNA stain SYBR Safe
Gel images
Protocol notes

Two separate PCR reactions were analyzed, an arthropod COI PCR and a Wolbachia 16S PCR. The submitted wasp sample produced a visible band on the arthropod COI gel, indicating that arthropod DNA was successfully extracted and amplified. The wasp sample did not produce a visible band on the Wolbachia 16S gel. The Wolbachia-positive DNA control produced a visible band, while the negative control and water control did not produce visible bands. The positive-control Drosophila lane did not show a clear visible band on the Wolbachia gel.

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

I selected medium confidence because the wasp sample produced a visible COI band, showing that DNA extraction and PCR amplification were successful. The wasp did not produce a visible Wolbachia 16S band. The Wolbachia-positive DNA control produced a band, and the negative and water controls did not produce bands, which supports a Wolbachia-negative result. However, the positive-control Drosophila lane did not show a clear band on the Wolbachia gel, so the result should be interpreted with some caution.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
TCTGAGCCGGAATAATTGGATCTTCCATAAGAATAATTATTCGATTAGAATTAGGATCGCCCGATGCTTTAATTAATAATGATCAAATTTATAATTCAATAGTAACTAGTCATGCCTTTATTATAATTTTTTTTATAGTAATACCTTTTATAATTGGAGGATTCGGAAACTTTTTAGTCCCATTAATATTAGGATCACCTGATATAGCATACCCTCGAATAAATAATATAAGATTTTGATTATTACCACCCTCTTTATCCTTACTTTTATTGAGTAATTTTATTAATGATGGGGTTGGGACAGGTTGAACTGTTTATCCCCCTTTAGCATCTAATATTTTTCATAGTGGTCCATCAGTTGATTTAGCAATTTTCTCCCTACATATTGCAGGAATATCCTCAATTTTAGGAGCCATTAATTTTATCTCTACAATTTTAAATATACACCATAAAAATTTCTCAATTGACAAAATCCCACTTCTTGTTTGGTCAATTTTAATTACTGCAATTCTATTATTATTATCTCTTCCTGTATTGGCCGGGGCAATTACTATATTACTAACAGACCGAAATTTAAATACTTCTTTTTTTGATCCTTCTGGAGGCGGGGATCCTATTCTTTATCAACATTTATTTTGATTTTTTGG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Hymenoptera was found to be negative for Wolbachia.
Report Inappropriate Post