Xysticus ferox (Common Ground Crab Spider, Wolbachia -)

Sample information

Picture
Entry by: Joe C.
Location
Collection date 05/25/2026
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

This Xysticus ferox was found on a rocky trail directly next to a suburban forest at the Pingry School in Basking Ridge, NJ. The specimen was resting on the ground, near the edge of the path, next to plants.

Putative identification Arthropoda Arachnida Araneae Thomisidae Xysticus

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system agarose gel electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

The experiment began with the extraction of DNA from the Xysticus ferox. To confirm DNA presence, a nanodrop was used, and the nanodrop found a concentration of 126.8 uL/ng. PCR was performed to amplify the Arthropod and possible Wolbachia DNAs. Following PCR, gel electrophoresis was run to determine the success of the previous protocols and to show expression of the DNA. In the end, the experiment found that the Xysticus ferox did not have Wolbachia.

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

In the top of the gel in lane 2, the gel showed no Wolbachia DNA in the specimen. Furthermore, the arthropod-positive and Wolbachia-positive DNA control fragments appeared on the gel (Bottom & Top of gel, respectively, Lane 3), as well as the Xysticus ferox arthropod DNA fragments (Bottom of gel, Lane 2), indicating that the protocols were correctly followed. However, the arthropod gene sequencing for the specimen did not exactly match any other previous submission. Yet, the sequence had a 98% match rate in comparison to a previously entered Xysticus ferox from a reliable inputter.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA   
TGGAGCTTGATCAGCTATAGTTGGGACTGCAATAAGAGTTTTAATTCGTATAGAGTTAGGAAATGTGGGTAGATTATTAGGGGATGATCATTTGTATAATGTAATTGTTACAGCTCATGCTTTTGTAATGATTTTTTTTATAGTAATACCTATTTTGATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGGGCTCCTGATATATCTTTTCCTCGAATAAATAATTTATCTTTTTGGTTACTCCCTCCTTCATTATTTTTATTATTTATATCATCTATAGTAGAAATAGGTGTCGGGGCTGGTTGAACTGTTTATCCTCCTTTAGCGTCTAGTATAGGGCATATAGGAAGATCAATAGATTTTGCTATTTTTTCTCTTCATTTAGCAGGTGCTTCATCAATTATAGGAGCTGTTAATTTTATTTCAACAATTATTAATATACGTGTAGTTGGTATATCTATAGAAAAAGTACCTTTATTTGTTTGGTCTGTTTTAGTGACAGCTATTTTACTTCTTTTATCTTTACCTGTTTTAGCAGGGGCTATTACAATATTACTTACTGATCGAAATTTTAATACTTCTTTTTTTGACCCTGCAGGAGGAGGAGATCCAATTTTATTTCAACATTTATTTTGATTTTTTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Xysticus was found to be negative for Wolbachia.
Report Inappropriate Post