Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 08/26/2020 |
| Captive / Cultivated? | Wild-caught |
| Group | Bordenstein Lab |
| Observations | Dozens of small ants were scurrying across the cement at a neighborhood swimming pool. One ant was collected at 3:15pm by placing a collection vial over top and allowing it to climb up. It was a cloudy day, 83F, 66% humidity. |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Lasius Lasius alienus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | |
| Gel electrophoresis system | MiniOne |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes | This sample is labeled as “small ant” on the above gels. The ant was stored in 70% ethanol at room temp for about 3 weeks prior to DNA extraction. DNA Extraction: The ant was incubated in lysis buffer at 56C for 2 hours. Because there was cell debris, I did a 30 sec spin and transferred the supernatant to a fresh tube of 200ul ethanol. This was placed in the freezer overnight and DNA was purified the following day. Eluted DNA was immediately incubated at 65C for one hour prior to PCR. PCR: MiniOne Taq polymerase was used. Gel electrophoresis: The arthropod gel looks whispy; however, that went away as the gel ran longer. This could have been caused by not adding loading dye to samples. The results were very clear, though. I re-colored the gel images in PowerPoint. The MiniOne ladder contains 5 bands: 100, 300, 500, 1000, and 2000 bp. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | The DNA extraction was successful because the arthropod COI amplified. Both (+) and (-) controls worked. The Wolbachia 16S rRNA band was absent. Sanger sequencing revealed that this is a cornfield ant, Lasius alienus. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
TTGAGCTGGTATAATTGGCTCATCTATAAGAATAATTATCCGACTAGAATTAGGTTCATCTAATTCATTAATTAATAATGATCAAATTTATAACTCTATAGTTACAAGGCACGCATTTGTTATAATTTTCTTCATAGTTATACCTTTCATAATTGGTGGATTTGGTAATTTTCTTGTACCTTTAATATTAGGTTCACCTGATATGGCTTACCCCCGTATAAATAATATAAGATTTTGACTTTTACCTCCCTCTATTTCTCTACTCCTTTTAAGAAATTTCATTAATGATGGAGTCGGAACAGGATGAACCGTTTATCCTCCTTTAGCCTCAAATATCTTCCATAATGGCCCTTCAGTTGATTTAACTATTTTCTCTCTTCACATCGCTGGAATATCTTCTATTTTAGGAGCTATTAATTTTATTTCAACTATTATAAACATACACCATAAAAATTTTTCTATTGATAAAATTCCACTACTTGTATGATCAATCTTAATTACTGCAATTTTACTACTTCTATCCCTTCCTGTTCTTGCAGGAGCTATTACTATACTTTTAACTGACCGTAACCTTAATACTTCATTTTTTGACCCATCAGGAGGTGG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Lasius alienus was found to be negative for Wolbachia. |



Bombus impatients (Eastern Bumblebee)
Agelenopis
My Data
Common Eastern Bumble Bee (Bombus impatiens)
American Bird