Sample information |
|
Picture |
|
---|---|
Location | |
Collection date | 09/13/2022 |
Captive / Cultivated? | Wild-caught |
Group | KantiWil |
Observations | in a spider web between two branches |
Putative identification | Arthropoda Chelicerata Arachnida Araneae Pisauridae Pisaura Pisaura mirabilis |
Methods |
|
Extraction kit | Instagene Matrix |
DNA extraction location | Partial abdomen |
Single or Duplex PCR | Duplex Reaction |
Gel electrophoresis system | Standard electrophoresis system |
Buffer | TAE |
DNA stain | SYBR Safe |
Gel images |
|
Protocol notes | |
Results |
|
Wolbachia presence | No |
Confidence level | Medium |
Explanation of confidence level | The lines were not well visible on the gel. However, it was more visible than in the picture. |
Wolbachia 16S sequence | |
Arthropod COI sequence | Download FASTA
Download AB1
AGTGGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAATTGATTAGTTCCTTTAATATTAGGAGCTCCTGATATATCATTCCCCCGAATAAATAATTTGTCTTTTTGACTTTTACCTCCTTCTTTATTTTTATTATTTATATCTTCTATAGTAGAAATAGGAGTTGGTGCTGGTTGAACAGTTTATCCTCCTTTAGCATCTACAGTTGGTCATATAGGAAGATCTATAGATTTTGCTATTTTTTCTTTACATTTAGCTGGGGCTTCTTCTA
BLAST at The Wolbachia Project BLAST at NCBI
|
Summary | The Pisaura mirabilis was found to be negative for Wolbachia. |