Oniscus Asellus/Oniscidea, the Common Woodlouse – JT01

Sample information

Picture
Entry by: Javier T, Daniel H.
Location
Approximate location: 40.62, -74.57
Collection date 05/30/2023
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

Specimen collected from underneath a log. The specimen is an even dark brown and has two antennae, 7 pairs of legs, and two uropods; it possesses essential characteristics of the common woodlouse, commonly referred to as a sowbug.

Putative identification

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Abdomen
Single or Duplex PCR
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

10-fold dilutions (20µl→ 18µl of distilled water, 2µl of original sample) were performed on template PCR due to the original DNA concentrations of the sample being too high, causing no reading on the gel. The gel submitted is the gel taken of the diluted samples, the second gel overall.

Results

Wolbachia presence Unknown
Confidence level High
Explanation of confidence level

The Wolbachia portion of the gel didn’t yield any results, including the controls(the only aspect visualized on the gel was the loading buffer). The only conclusive results were sample 2 in lane 2 of the arthropod portion of the gel, as a band is clearly pictured at around 700 bp(base pairs) on the gel. In addition, the arthropod controls yielded results at around 700 bp.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GCTGTTGGAACAGCCCTTAGGATAATTATTCGAACTGAGTTAGGAAACCCTGGGAGGTTAATTGGAGACGATCAGATTTATAATGTGATTGTTACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGCTTTGGTAATTGATTAGTACCTTTAATATTAGGGGCCCCTGATATAGCTTTTCCACGTATAAATAATATAAGATTTTGGCTTCTTCCCCCATCACTAATTTTGTTATTAAGAAGAGGTTTAGTTGAAAGAGGTGTTGGGACTGGCTGGACTGTCTACCCACCTTTGGCAAGTGGAATTGCCCATAGAGGGGCTTCAGTAGATTTAGGGATTTTTTCCCTTCATTTGGCTGGAGCTTCTTCAATTTTAGGAGCTGTAAATTTTATTACTACTGTAATTAATATACGAGCAGAGGGGATAAGGATAGATCGTGTCCCTCTATTTGTTTGGTCAGTGTTAATTACAGCAATTCTCTTGTTACTTTCACTACCAGTTTTATCAGGGGCCATTACTATGTTATTAACAGACCGTAATCTGAACACCTCTTTTTTCGACCCTAGGGGGGGAGGAGATCCTATCTTGTACCAACACTTATTTTGATTTTTTGGTCACACAAAA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary
Report Inappropriate Post