Pale Green Assassin Bug – Aarav

Sample information

Picture
Entry by: Aarav S., Will P.
Location
Approximate location: 40.62, -74.57
Collection date 06/07/2023
Captive / Cultivated? Wild-caught
Group Pingry School
Observations

We found the bug sitting on the edge of a log. The bug was very well camouflaged and looked exactly like a living leaf. While dissecting the bug, we saw a blue-like substance inside the abdomen which we couldn’t identify.

Putative identification Arthropoda Insecta Hemiptera

Methods

Extraction kit DNeasy (Qiagen) blood and tissue kit
DNA extraction location Whole arthropod
Single or Duplex PCR Single Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

The sample extracted from the Pale Green Assassin Bug is in lane 4. The top half of the gel shows results for the CO1 gene, and the bottom half shows results for the 16S gene. We prepped the samples and then ran them through a gel for approximately 20 minutes at 100v. We then ran the gel for approximately 15 minutes at 10v while waiting to view results. The sample in Lane 4 (Pale Green Assassin Bug) had a band that lined up with the band from the + arthropod control, meaning our putative insect had a positive band at the CO1 arthropod gene. The sample in lane 4 (Pale Green Assassin Bug) also had a band that lined with the expected + Wolbachia control band, meaning the insect had the 16S gene and Wolbachia infection.

Results

Wolbachia presence Yes
Confidence level High
Explanation of confidence level

The band in lane 4 (Pale Green Assassin Bug) that lined up with the + arthropod control was very dark and thick. Furthermore, the band that lined up with the + Wolbachia control was very visible. We further went on to test the DNA concentration of the CO1 and 16S samples of the Pale Green Assassin Bug in a Nanodrop, and found the concentrations to be 16.2ng/uL and 7.9ng/uL respectively, meaning the samples had DNA.

Wolbachia 16S sequence Download FASTA    Download AB1
TAAGCCTGCCGACTTATCAGCCCAGTGAAGACACCATGGTAGCAAGTGTGTAGCGCACTCTCCAAAGAGCATGATGATGTGATATAATTACCAGCTCCTAANATTGAACATAGGCAGTTTCCTTGTGTTGAGAGCATTGCCCGATGGCCACTGGGGCCTCCGGTTGCGCTGGNTGCGGGACTTAGCGGGGCAGCTCATGCANCAGCTTACTACCCCTCTGTCGCCAATTCGTCTAGTCCGTCCGCACCGTGCGTATTCGTTNGAATAGGTCTGANACTTTTTTTGTTATTTCTTTANTANGG
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence Download FASTA    Download AB1
TGGATCACCTCCCCCAGATGGGTCAAAGAATGAAGTATTAAAGTTTCGATCAGTTAATAGCATAGTAATAGCCCCTGCTAAAACAGGAAGAGATAATAATAAAAGTAATGCAGTAATTCCTACTGATCAGACAAATAATGGGATTCGTTCAGGAGTTATTCCAGCAGGTCGTATATTAATAATTGTTGAAATAAAATTAACTGCTCCTAAGATTGAAGATACTCCGGCTAAGTGTAATGAGAAAATTGCTAAATCTACAGCTGCACCTCTATGAGCTATATTACTAGATAAGGGGGGATAAACAGTCCATCCTGTTCCTGCCCCTCCTTCAGCAATTCTTCTAATTAATAACAAGGTTAGGGAAGGGGGAAGAAGTCAAAATCTTATATTATTTATTCGGGGGAAGGCTATATCAGGAGCTCCAATTATAAGGGGTACTAATCAATTCCCAAATCCTCCAATTATAATAGGCATAACTATAAAGAAAATCATAATAAATGCGTGTGCAGTAACGAATACATTATAAATTTGATCATTTCCAATAAAAGTACCTGGAGTACCTAATTCAATTCGAATTATTCATCTTAAGGAGGTTCCAATAACCCCTGCTCAAGCACCTAGCAGAAAATATAGAGTTCCAATATCTAT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Hemiptera was found to be postive for Wolbachia.
Report Inappropriate Post