Allonemobius Fasciatus

Sample information

Picture
Photos by: Keazia H.G
Location
Collection date 10/20/2023
Captive / Cultivated? Wild-caught
Group Edmund Burke School
Observations
  • Was loud in sound and could hear from a distance away.
  • Had a lengthy body including torso, arms, and legs
  • was somewhat small
  • ¬†brown color
  • 6 legs
  • lived in a largely populated habitat with other arthropods similar to it
Putative identification Arthropoda Hexapoda Insecta Orthoptera

Methods

Extraction kit DNeasy (Qiagen)
DNA extraction location Abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system MiniOne
Buffer TBE
DNA stain GelGreen
Gel images
Protocol notes

DNA Extraction: the arthropod was rather easy to grind up and was an easy process. No mistakes were made.

PCR: No mistakes were made and everything went smoothly.

Gel electrophoresis, Wolbachia:

Each lane was present for an arthropod gene except the water and the Wolbachia gene was present in only arthropod C1 and the positive Wolbachia control. The controls worked and no mistakes were made. Which means my results are accurate.

 

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

I have a high confidence level because all procedures were done carefully without mistakes therefore results are accurate and clear.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
Query 1 TTTATAACGTTATTGTAACAGCCCACGCATTTGTAATAATTTTCTTTATAGTTATACCCA 60 |||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||| Sbjct 111 TTTATAACGTCATTGTAACAGCCCACGCATTTGTAATAATTTTTTTTATAGTTATACCCA 170 Query 61 TTATAATTGGGGGNNNCGGAAATTGATTAGTACCTTTAATGTTATCAGCCCCTGATATAG 120 | |||||||| || |||||||||||||||||||||||||||||||||||||||||||| Sbjct 171 TCATAATTGGAGGATTCGGAAATTGATTAGTACCTTTAATGTTATCAGCCCCTGATATAG 230 Query 121 CATTCCCCCGAATAAATAATATAAGATTTTGGCTTCTTCCTCCATCATTAACTTTACTTT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 231 CATTCCCCCGAATAAATAATATAAGATTTTGGCTTCTTCCTCCATCATTAACTTTACTTT 290 Query 181 TATCTAGAAGAATAGTAGAAAATGGAGCAGGAACTGGTTGAACAGTATACCCTCCTTTAT 240 ||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| Sbjct 291 TATCTAGAAGAATAGTAGAAAATGGAGCAGGTACTGGTTGAACAGTATACCCTCCCTTAT 350 Query 241 CTTCCTTAATTGCTCACGGAGGAGCATCNGTANATTTAGCTATCTTCTCCCTACACCTAG 300 |||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| Sbjct 351 CTTCCTTAATTGCTCACGGAGGAGCATCCGTAGATTTAGCTATCTTCTCCCTACACCTAG 410 Query 301 CAGGAATTTCCTCTATTTTAGGAGCAATTAACTTTATTTCAACNNNNATTAATATACNAG 360 ||||||||||||||||||||||||||||||||||||||||||| |||||||||| || Sbjct 411 CAGGAATTTCCTCTATTTTAGGAGCAATTAACTTTATTTCAACTATAATTAATATACGAG 470 Query 361 CTCCCGGCATAACTCTANNNNNNACCCNNNNNNTTGTGNNNNNNGTANGAATNNNNGCCC 420 ||||||||||||||||| |||| ||||| ||| | || |||| Sbjct 471 CTCCCGGCATAACTCTAGACCAAACCCCCCTATTTGTGTGAGCAGTAGGGATCACTGCCC 530 Query 421 TCCTTCNTCNTCTTTCATTGCCNGTTCTTGCNNGNGCTATTACNNNACTTTTANCAGATC 480 |||||| || ||||||||| || |||||||| | |||||||| ||||||| |||||| Sbjct 531 TCCTTCTTCTTCTTTCATTACCTGTTCTTGCAGGTGCTATTACCATACTTTTAACAGATC 590 Query 481 NAANTTNANACACNTCANTTTTTG 504 || || | |||| ||| |||||| Sbjct 591 GAAATTTAAACACATCATTTTTTG 614
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Orthoptera was found to be negative for Wolbachia.
Report Inappropriate Post