Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 07/09/2023 |
| Captive / Cultivated? | Wild-caught |
| Group | Edmund Burke School |
| Observations |
The insect was found in a grassy park in a highly urban environment near a large river, found under a rock in a cool, wet area. The temperature at the location was 34 °C during summer, in a climate where warm summers and very cool winters are expected. The insect has vertical ribbing along the top surface of the abdomen, it appears to have 6 legs, with medium-large mandibles given the body size. It has a very dark brown, almost black, exoskeleton, which appears with a slight red hue in certain lighting conditions. The limbs have a more red-brown color than the body. |
| Putative identification | Arthropoda Insecta Coleoptera Carabidae Scarites Scarites subterraneus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | MiniOne |
| Buffer | TBE |
| DNA stain | GelGreen |
| Gel images |
|
| Protocol notes |
DNA Extraction The extraction procedure didn't have any observed errors. Due to the size of the insect, the abdomen was separated from the rest of the insect. A chunk of the exoskeleton came off the abdomen throughout this process; however, this shouldn't have any impact on the results. When grinding the arthropod, there were a few chunks left behind from the exoskeleton, which isn't important since all the abdominal tissue was ground sufficiently.
DNA Extraction The extraction process went fairly well. The insect easily ground into a thin consistency. No errors were observed during the procedure, apart from an unknown amount of Buffer AW1 being added. However, that shouldn't matter as the amount is higher than 500ul, and it was being flowed through a filter at the end. PCR & Gel electrophoresisPCR was successful, with all controls returning the expected results. The gel electrophoresis was also successful; however, sample F1 on the CO1 gel had a very light line. This didn't impact results, however. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level |
All controls returned their expected results and there were no known sources of major contamination. Both gels resulted in clear results and sequencing was overall high quality. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AGTAGGAACTTCTTTAAGTCTATTAATTCGAGCAGAATTAGGGAATCCAGGATCACTAATTGGTGATGAT CAAATTTATAATGTTATTGTTACTGCCCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAA TTGGTGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCACCTGATATGGCCTTTCCTCGAATAAA TAATATAAGTTTTTGACTTTTACCTCCTTCTTTAACACTTCTTCTTATAAGAAGACTAGTAGAAAGAGGA GCAGGTACAGGTTGAACTGTATACCCCCCTTTATCTTCAGGAATTGCCCATAGAGGTGCTTCAGTAGATT TAGCTATTTTTAGTCTTCACTTAGCAGGGGTATCCTCTATTTTAGGAGCAGTTAATTTTATTACTACTAT TATCAATATACGATCAGTAGGTATAACATTTGAACGAATACCACTATTTGTTTGATCAGTAGGTATTACA GCTTTACTATTACTTTTATCATTACCAGTTTTAGCAGGAGCTATTACTATGTTATTAACAGATCGAAATT TAAATACTTCCTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Scarites subterraneus was found to be negative for Wolbachia. |






Camponotus Pennsylvanicus
North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug