Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | In a log under bark |
| Putative identification | Arthropoda Arachnida Araneae Anyphaenidae Anyphaena Anyphaena accentuata |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Whole arthropod |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | NP1: The stripes are very clear for the Wolbachia 16S rDNA and mitochondrial Cytochromoxidase. This means the process of the experiment worked well. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
TAATTCGTATAGAGTTAGGACAATCAGGAAGATTTTTAGGTGATGATCATATATATAATGTGATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Anyphaena accentuata was found to be negative for Wolbachia. |



Umbrella Wasp
Fannia Canicularis
Oulema Obsucra JM2
Collembola
Linyphiidae BK1