Anyphaena accentuata NP1

May 2, 2024

Sample information
Picture
Photos by: Niclas P.
Location
Collection date
Captive / Cultivated? Wild-caught
Group KantiWil
Observations

In a log under bark
Putative identification Arthropoda Chelicerata Arachnida Araneae Anyphaenidae Anyphaena Anyphaena accentuata

Methods
Extraction kit Instagene Matrix
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Results
Wolbachia presence No
Confidence level High
Explanation of confidence level

NP1: The stripes are very clear for the Wolbachia 16S rDNA and mitochondrial Cytochromoxidase. This means the process of the experiment worked well.
Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
TAATTCGTATAGAGTTAGGACAATCAGGAAGATTTTTAGGTGATGATCATATATATAATGTGATTGTAACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATACCTATT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Anyphaena accentuata was found to be negative for Wolbachia.
Report Inappropriate Post