Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 03/07/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | KantiWil |
| Observations | Habitat -> under the bark of a fir tree |
| Putative identification | Arthropoda Diplopoda Polydesmida Polydesmidae Polydesmus Polydesmus angustus |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Rear half |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
CTATAAGAGGTTTTATTCGTTTGGAGTTGGGTGTTCCTGGAAGTTTCATAGGGGATGATCATATTTTTAATGTAGTTGTTACTGCTCATGCTTTTGTTATAATTTTTTTTATG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Polydesmus angustus was found to be negative for Wolbachia. |


Ant like creature – Draft
Myrmaplata plantaleoides (Unsure) – Draft
leaf hopper nymph
Pheidole species (Minor Worker)
JTR 1