Mosquito

Sample information

Picture
Location
Collection date 11/01/2020
Captive / Cultivated? Wild-caught
Group St. Albans School
Observations

Found on the garage door near my house at around 3:30 PM. It had rained the night before.

Putative identification Hexapoda Insecta Diptera Culicidae Aedes Aedes albopictus

Methods

Extraction kit Instagene Matrix
DNA extraction location Abdomen
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We first ran a duplex reaction. Then, we ran two separate PCR reactions: one with just Wolbachia primers, and one with just COI primers.

Results

Wolbachia presence Yes
Confidence level High
Explanation of confidence level

We ran a second PCR reaction with just Wolbachia primers which also came back positive, confirming Wolbachia positivity in the mosquito.

Wolbachia 16S sequence Download FASTA    Download AB1
GTTGGGTTAAGTCCCGCAACGAGCGCAACCCTCATCCTTAGTTGCTATCAGGTAATGCTGAGTACTTTAAGGAAACTGCCAGTGATAAGCTGGAGGAAGGTGGGGATGATGTCAAGTCATCATGGCCTTTATGGAGTGGGCTACACACGTGCTACAATGGTGTCTACAATGGGTTGCAAGGTGCGCAAGCCTAAGCTAATCCCTAAAAGACATCTCAGTTCGGATTGTACTCTGCAACTCGAGTACATGAAGTTGGAATCGCTAGTAATCGTGGATCAGCATGCCACGGTGAATACGTTCTCGGGTCTTGTACACACTGCCCGTCACGCCATGGGAATTGGTTTCACTCGAA
BLAST at The Wolbachia Project   BLAST at NCBI
Arthropod COI sequence Download FASTA    Download AB1
CTAAGAGTTTTAATTCGTATTGAACTTAGACATCCTGGTATATTTATTGGAAATGATCAAATTTATAATGTAATTGTTACTGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCTATCATAATTGGAGGATTTGGAAACTGACTAGTACCCTTAATACTAGGAGCCCCTGATATAGCTTTTCCTCGAATAAATAATATAAGTTTTTGAATATTACCCCCCTCTTTAACACTGCTGCTTTCTAGTTCTATAGTAGAAAACGGAGCTGGAACAGGGTGAACGGTTTATCCTCCTCTTTCTTCTGGAACAGCTCATGCTGGGGCTTCAGTTGATTTAGCAATTTTTTCTTTACATTTAGCGGGAATCTCATCTATTTTAGGAGCAGTAAATTTTATTACAACTGTAATTAATATACGATCAACTGGTATTACTCTTGATCGACTACCTTTATTTGTGTGATCAGTAGTAATTACAGCTATTTTATTACTTCTTTCTCTACCCGTATTAGCCGGAGCTATTACTATATTATTAACAGACCGAAATTTAAATACATCTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Aedes albopictus was found to be postive for Wolbachia.
Report Inappropriate Post