Sample information |
|
Picture |
![]() ![]() |
---|---|
Location | |
Collection date | 10/27/2020 |
Captive / Cultivated? | Wild-caught |
Group | St. Albans School |
Observations | I found this ladybug larvae on the front porch of my home underneath a light. It was the only one nearby. |
Putative identification | Hexapoda Insecta Coleoptera Coccinellidae Harmonia Harmonia axyridis |
Methods |
|
Extraction kit | Instagene Matrix |
DNA extraction location | Abdomen |
Gel electrophoresis system | Standard electrophoresis system |
Buffer | TAE |
DNA stain | SYBR Safe |
Gel images |
![]() |
Protocol notes | |
Results |
|
Wolbachia presence | No |
Confidence level | High |
Explanation of confidence level | There was no band which matched the control band in the gel. |
Wolbachia 16S sequence | |
Arthropod COI sequence | Download FASTA
Download AB1
CTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTT
BLAST at The Wolbachia Project BLAST at NCBI
|
Summary | The Harmonia axyridis was found to be negative for Wolbachia. |