Ladybug

Sample information

Picture
Photos by: William D
Location
Collection date 10/27/2020
Captive / Cultivated? Wild-caught
Group St. Albans School
Observations

I found this ladybug larvae on the front porch of my home underneath a light. It was the only one nearby.

Putative identification Hexapoda Insecta Coleoptera Coccinellidae Harmonia Harmonia axyridis

Methods

Extraction kit Instagene Matrix
DNA extraction location Abdomen
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

There was no band which matched the control band in the gel.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
CTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTT
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Harmonia axyridis was found to be negative for Wolbachia.
Report Inappropriate Post