Ladybug

Sample information

Picture
Photos by: K. O'Brien
Location
Collection date 10/31/2020
Captive / Cultivated? Wild-caught
Group St. Albans School
Observations

I found this ladybug on my kitchen window at home.  There were about 5-6 ladybugs trying to get into window from outside.

Putative identification Hexapoda Insecta Coleoptera

Methods

Extraction kit Instagene Matrix
DNA extraction location Abdomen
Gel electrophoresis system Standard electrophoresis system
Buffer TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We first ran duplex PCR reaction (with both COI and Wolbachia primers) and then ran separate PCR reactions with just COI and just Wolbachia primers

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

We originally though the ladybug might be Wolbachia positive because we saw a smaller band (though slightly different size the Wolbachia positive control) with the duplex PCR reaction.

We then ran the DNA sample with Wolbochia and COI each separately as single PCR reactions and you can see that there is no band for Wolbachia.

Interestingly, there is a double band with the COI primers, and, upon consult with Sarah Bordenstein, we thinks we have either have a NUMT (most likely) or different mitochondria variants in the ladybug.”

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
AGTAGGAACATCGTTAAGTATTTTAATTCGGTTAGAATTAGGAACTAGAGGAAGATTAATTGGAAACGACCAAATTTATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGAAATTGATTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCATTTCCACGATTAAATAACATAAGATTTTGACTTTTACCCCCTGCTTTAACTCTTTTAATTTTAAGAACAATCGTAGAAATAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTTTGACCCAACCGGTGGGGGAGACCCAATTTTATACCAACATTTATTTTGATTTTTTG
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Coleoptera was found to be negative for Wolbachia.
Report Inappropriate Post