Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 10/31/2020 |
| Captive / Cultivated? | Wild-caught |
| Group | St. Albans School |
| Observations | I found this ladybug on my kitchen window at home. There were about 5-6 ladybugs trying to get into window from outside. |
| Putative identification | Arthropoda Insecta Coleoptera |
Methods |
|
| Extraction kit | Instagene Matrix |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | We first ran duplex PCR reaction (with both COI and Wolbachia primers) and then ran separate PCR reactions with just COI and just Wolbachia primers |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | We originally though the ladybug might be Wolbachia positive because we saw a smaller band (though slightly different size the Wolbachia positive control) with the duplex PCR reaction. We then ran the DNA sample with Wolbochia and COI each separately as single PCR reactions and you can see that there is no band for Wolbachia. Interestingly, there is a double band with the COI primers, and, upon consult with Sarah Bordenstein, we thinks we have either have a NUMT (most likely) or different mitochondria variants in the ladybug.” |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
Download AB1
AGTAGGAACATCGTTAAGTATTTTAATTCGGTTAGAATTAGGAACTAGAGGAAGATTAATTGGAAACGACCAAATTTATAATATAATTGTTACAGCTCATGCTTTCATTATAATTTTCTTTATAGTAATACCTATTATAATTGGGGGTTTTGGAAATTGATTAGTTCCTTTAATAATTGGAGCTCCTGATATAGCATTTCCACGATTAAATAACATAAGATTTTGACTTTTACCCCCTGCTTTAACTCTTTTAATTTTAAGAACAATCGTAGAAATAGGGGCAGGAACAGGATGAACTGTTTACCCTCCTCTTTCTTCTAATTTAACACATAATGGGCCTTCAGTAGATTTAGTGATTTTTAGTTTACATTTAGCAGGAATTTCCTCAATTTTAGGTGCAGTAAATTTCATTTCAACTATTATAAATATACGTCCATTTGGTATAATACTTGATAAAACTCCTTTATTTGTATGATCTGTTCTTATTACAGCAATTCTTTTATTACTATCACTACCAGTTCTTGCAGGAGCAATTACTATACTATTAACTGACCGAAACTTAAATTCTTCTTTTTTTGACCCAACCGGTGGGGGAGACCCAATTTTATACCAACATTTATTTTGATTTTTTG
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Coleoptera was found to be negative for Wolbachia. |



Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera
Cisseps Fulvicollis