Sample information |
|
Picture |
|
---|---|
Location | |
Collection date | 08/25/2024 |
Captive / Cultivated? | Wild-caught |
Group | Kantonsschule Zuercher Unterland |
Observations | Behind the house, lying on the gras without the ability to fly. I caught it with a glas. |
Putative identification | Arthropoda Hexapoda Insecta Hymenoptera Vespidae Polistinae Polistes |
Methods |
|
Extraction kit | Instagene Matrix |
DNA extraction location | Partial abdomen |
Single or Duplex PCR | Single Reaction |
Gel electrophoresis system | MiniOne |
Buffer | TBE |
DNA stain | Midori 1:20'000 |
Gel images |
|
Protocol notes | strong faint, in the picture its the 4th lane |
Results |
|
Wolbachia presence | No |
Confidence level | High |
Explanation of confidence level | After analyzing the DNA with the BLAST tool, Polistes dominula the was a near to exact match with a similarity 99.51% so that was the reason for our confidence. As we compared it with our initial identication of the insect with a book we came to the conclusion, that we had found the exact same insect. So the pictures match with the result and the identification of the BLAST confirms it. We are very confident that our specimen is a Polistes dominula. Picture from Wikipedia as a comparison. |
Wolbachia 16S sequence | |
Arthropod COI sequence | Download FASTA
Download AB1
TAAGANTAATAATTCGATTAGAATTAGGAACACCATCTTCAATTATTAATAATGATCAATTTTATAATTCAATTATTACA GCCCATGCTTTAGTAATAATTTTTTTTATAGTTATACCATTTATAATTGGAGGTTTTGGAAATTGATTAATTCCTATAAT ACTTGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGACTTTTACCACCCTCATTATTTTTGCTTA TTATAAGAAACATAATAAAAATAGGAGTAGGAACAGGATGAACTTTATACCCACCTTTATCTTCAAATATTGGACATAAT TCACCTTCTGTTGATTTATCAATTTTTTCTCTTCATATTGCTGGAATTTCATCCATTATAGGAGCTATTAATTTTATTGT AACAATTTTAAATATACATATTAAAACCCATTCATTAAATTTTTTACCTTTATTTACATGATCTGTTTTAATTACAGCAA TTTTACTTTTATTATCTTTACCTGTCTTAGCAGGAGCAATCACTATACTATTAACTGATCGAAATTTAAATACATCTTTT TTTGATCCTACAGGAGGAGGTGANCCAATTTTATTTCAACATCTATTTTGANTTTTTG
BLAST at The Wolbachia Project BLAST at NCBI
|
Summary | The Polistes was found to be negative for Wolbachia. |