Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 10/31/2024 |
| Captive / Cultivated? | Wild-caught |
| Group | Longwood University |
| Observations | Fall 78 Degrees Fahrenheit Found in wildflowers near Lake Mayes |
| Putative identification | Arthropoda Insecta Lepidoptera Hesperiidae Atalopedes Atalopedes huron |
Methods |
|
| Extraction kit | promega wizard SV |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | Ethidium Bromide |
| Gel images |
|
| Protocol notes | |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | All controls worked as expected. There were no issues with the protocol, and none of the bands on the gel were surprising. The genetic identification of the organism matched the morphological identification of the organism, verifying its identity. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download AB1
ATTAGGAACTTCTTTAAGATTATTAATTCGAACAGAACTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATCGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAACATAAGATTTTGAATATTACCTCCTTCATTAACATTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACTGTTTATCCTCCTTTATCCTCAAACATTGCTCATCAAGGATCTTCTGTTGATTTAGCTATTTTTTCTCTTCATTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATCATTAATATACGAATTAAAAATTTATCATTTGATCAAATACCTTTATTTGTATGATCTGTAGGAATTACAGCATTACTATTATTGTTATCTTTACCTGTATTAGCAGGAGCTATTACTATATTACTTACAGATCGAAATT
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Atalopedes huron was found to be negative for Wolbachia. |


Differential Grasshopper – Melanoplus differentialis
Pill Bug (Armadillidium vulgare) – Draft
Melanoplus Femurrubrum
Grasshopper – Orthoptera
Cisseps Fulvicollis