Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 05/09/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | California Academy of Mathematics and Science |
| Observations | Bug was found on the leaves of a bush. |
| Putative identification | Arthropoda Insecta Hemiptera Pentatomidae Murgantia Murgantia histrionica |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Body without legs |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system Bio-Rad |
| Buffer | 1X TAE |
| DNA stain | 100X Fast Blast |
| Gel images |
|
| Protocol notes | Gel electrophoresis was run successfully and bands of harlequin bug DNA were present. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | During Gel Electrophoresis the bands for wolbachia presence as given by the DNA positive did not appear and the barcodes between the harlequin bug and the wolbachia are visually different meaning that it can be seen no wolbachia is present. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence |
NNNNNNNNNNNNNNTGNNNNNNNANANNNGGTATAGTTGGTACTTCTTTAAGAATCCTAATTCGCCTAGAACTAGGAACA ACTAATAGATTAATTGGAAACGACCAAATTTATAATGTAATTGTTACTGCTCATGCATTTATTATAATTTTTTTCATAGT AATACCTATTATAATTGGAGGATTTGGAAATTGACTAGTACCATTAATAATTGGCGCTCCAGATATAGCTTTCCCACGTT TAAATAATATAAGATTTTGACTTTTGCCTCCCGCATTAACATTATTAATAATAAGAATAATTGTAGAAATAGGGGCAGGC ACAGGTTGAACAGTCTACCCTCCACTATCTTCAAATTTGGCACATAATGGACCCTCTGTTGATTTAGTAATTTTTAGTTT ACATTTAGCTGGAATTTCGTCTATTTTAGGGGCTGTTAATTTTATTTCAACTATTATAAATATACGCCCTTCGGGAATAA GATTAGATAAAACTCCCTTATTTGTTTGATCAGTTATGATCACAGCTATTTTATTACTTTTATCTTTACCTGTATTAGCA GGAGCCATCACTATACTTTTAACAGATCGAAATATCAATACTTCATTTTTTGACCCTACGGGAGGGGGAGACCCTATTCT TTACCAACATTTATTCTGATTTTTTGGTCACCCTTGAAANTNNN
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Murgantia histrionica was found to be negative for Wolbachia. |


Camponotus Pennsylvanicus
North American Wheel Bug
Cicurina (Meshweaver spider)
Tufted Clusterfly
Juvenile Pillbug