Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 04/30/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | California Academy of Mathematics and Science |
| Observations | When caught, the beetle tried to dig out of its container. |
| Putative identification | Arthropoda Insecta Coleoptera Carabidae Anisodactylus Anisodactylus binotatus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Standard electrophoresis system Bio-Rad |
| Buffer | 1X TAE |
| DNA stain | UView |
| Gel images |
|
| Protocol notes | Gel 1 Gel 2 Our first gel’s ladder did not run successfully, so we ran another gel with the same ladder and and another MiniOne ladder and compared the relative mobilities of the two gels to determine the base pairs of the first gel. |
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | Although our controls worked, we are unsure of why our ladder did not run, so the results of our gel are somewhat questionable. However, all of the samples ran correctly, with aligned bands that were only in expected locations |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download FASTA
NNNTNNNNTNTTTGNAGCATGATCAGGAATAGTAGGGACTTCTTTAAGCATATTAATTCGAGCTGAATTAGGAACTCCTG GTGCATTAATTGGTGACGATCAGATTTATAATGTTATTGTTACTGCTCATGCTTTTGTAATAATTTTTTTTATAGTAATA CCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGTGCTCCTGATATAGCATTTCCTCGAATAAA TAATATAAGTTTTTGATTATTACCTCCATCATTAACCCTTCTTTTAATGAGAAGAATGGTTGAAAGAGGAACTGGGACTG GTTGAACAGTTTACCCTCCTTTATCATCTGGTATTGCCCATGGAGGAGCTTCAGTAGATTTAGCTATTTTTAGATTACAT TTAGCTGGAGTATCTTCAATTTTAGGGGCAGTAAATTTTATTACAACAATTATTAATATACGATCAGTAGGTATAACATT TGATCGTATACCATTATTTGTTTGATCAGTAGGAATTACTGCATTACTTTTATTATTATCTTTACCAGTACTAGCAGGAG CAATTACTATATTATTAACAGATCGAAATTTAAATACTTCTTTTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATA CCAACATTTATTTTGATTTTTTGGTCACCNGNNAAGTTNNAA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Anisodactylus binotatus was found to be negative for Wolbachia. |



Benedictine University Student-Chris R
Benedictine University Student – Grace M
(no title)
Halyomorpha halys
Coccinella septempunctata