Wild Caught Ant – Pittsfield, MA

Sample information

Picture
Entry by: Hanna F.
Location
Approximate location: 42.47, -73.25
Collection date 09/30/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations

Collected around 06:30 pm outside on the east side of the collector’s home. The arthropod was observed walking quickly along a brick walkway.

Putative identification Arthropoda Insecta Hymenoptera Formicidae Lasius Lasius neoniger

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Whole arthropod
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Edvotek Gel Electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes
  • Used a DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction kit (Product #T3010).
  • The specimen was incubated for 42.38 minutes in a hot water bath at 56 degrees C.

 

Our first PCR was set up on 10/15/25 and:

  • was a duplex reaction because we used both the arthropod CO1 and Wolbachia 16S primers together
  • used an annealing temperature of 49 degrees Celsius
  • used this Taq polymerase: New England Biolabs OneTaq Hot Start Quick-Load 2X Master Mis with Standard Buffer (#M0488S)

Our first gel image was taken on 10/22/25 and

  • was run at 125 volts for 24 minutes
  • used this DNA ladder: New England Biolabs 1 kb Plus DNA Ladder for Safe Stains (product # N05595S)

Our second PCR was set up on 10/29/25, used the same Taq polymerase as the first PCR reaction, and:

  • was a Single reaction that used the Arthropod CO1 primer.
  • used an annealing temperature of 49° Celsius.
  • Differed from the standard protocol in that when we mixed the PCR cocktail, we mistakenly used the amount of water used in a Duplex PCR reaction so we ran out of PCR cocktail and had to mix a single batch of PCR cocktail for the water control which ended being short. The source of the error was identified afterward.

Our second Gel image was taken on 11/5/25 and:

  • was run at 125 volts for 23 minutes.
  • used this DNA ladder: New England Biolabs 1 kb Plus DNA Ladder for Safe Stains (product # N0559S).

Results

Wolbachia presence No
Confidence level High
Explanation of confidence level

For results of gel electrophoresis run on 10/22/25 using the DNA ladder in lane 1 as a band size reference in bp (base pairs), I was able to determine sample 2-HF (Laius ant) in lane 3 had one band around 700bp, showing the presence of the CO1 gene, which confirms successful arthropod DNA extraction. No other bands were present, indicating no Wolbachia 16S was detected in sample 2-HF. The controls in lanes 3 through 7 performed as expected with the (+) arthropod control showing a band at 700bp for CO1 and a band around 400bp indicating the presence of 16S Wolbachia. The (-) arthropod control only showed one band at 700bp for the C01 gene. The (+) DNA control also showed 2 bands indicating presence of the CO1 gene and Wolbachia 16S.  The final control in lane 7 was the sterile, nuclease-free water which showed no bands and a faint primer dimer. I have a high confidence level in the results based on the success of the controls and the clarity of the results.

 

For results of gel electrophoresis run on 11/5/25 using the DNA ladder in lane 1 as a band size reference in bp (base pairs), we see again that sample 2-HF (Laius ant) in lane 3 had one band around 700bp, showing the presence of the CO1 gene, which confirms successful arthropod DNA extraction. The controls in lanes 3 through 7 performed as expected with the (+) arthropod and (-) arthropod controls and the (+) DNA control all showed a band at 700bp for CO1 as expected. The final control in lane 7 was the sterile, nuclease-free water which showed no bands as it should. I have a high confidence level in the results based on the success of the controls and the clarity of the results.

Wolbachia 16S sequence
Arthropod COI sequence Download FASTA    Download AB1
GAGCTGGTATAATCGGCTCATCTATAAGAATAATTATTCGTCTAGAATTAGGATCATCTAATTCATTGATTAATAATGATCAAATTTATAATTCTATAGTTACAAGACATGCATTCATTATAATTTTCTTTATAGTTATGCCTTTCATAATTGGAGGATTTGGAAATTTCCTTGTACCTTTAATATTAGGCTCACCTGATATAGCTTATCCACGTATAAACAATATGAGATTTTGACTTTTACCCCCCTCAATTTCTCTTCTTATTTTAAGAAATTTTATTAATGATGGTGTTGGGACAGGATGAACTGTTTATCCTCCTTTAGCTTCAAATATTTTCCATAATGGACCTTCAGTTGATTTAACTATTTTTTCCCTTCATATTGCTGGTATATCTTCAATTTTAGGAGCTATTAATTTTATTTCAACTATCTTAAATATACATCACAAAAATTTTTCTATTGATAAAATCCCTTTACTTGTATGATCAATTTTAATTACTGCAATTTTACTTCTCTTATCCTTACCCGTTCTTGCAGGAGCTATTACTATACTTTTAACTGACCGTAATCTTAACACTTCATTTTTTGATCCATCAGGTGGCGGAGATCCTATTTTATATCAACATCTTTTTTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Lasius neoniger was found to be negative for Wolbachia.
Report Inappropriate Post