Stink Bug – 3-JJB

Sample information

Picture
Entry by: Jose B.
Location
Collection date 09/29/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations

I caught this infamous species in a close garden; it was consuming rotten tomatoes near by a composter.

Putative identification Arthropoda Insecta Hemiptera Pentatomidae Halyomorpha Halyomorpha halys

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Partial abdomen
Single or Duplex PCR Single Reaction
Gel electrophoresis system Edvotek Gel Electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes
  • We used a DNA extraction method based on the insect adaptation of New England Biolabs Monarch Spin gDNA Kit (# T3010)
  • The specimen was incubated for 30 minutes in hot water at 56 degrees C.
  • During the last step of the DNA extraction we added too much elution buffer.
  • The PCR reaction held on 10/16/2025 and it was a duplex reaction in which we used Wolbachia 16S and Arthropod CO1 primers simultaneously.
  •  TAQ Polymerase; New England Biolabs OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer (#M0488S) was utilized.
  • Annealing temperature of 49 degrees C.
  • Our first gel image was taken on 10/23/25, and it was run at 125volts for 25 minutes.
  • New England Biolabs provided DNA ladder for Safe Stains (#N0559S).

PCR 2 – Gel Electro 2

  • The PCR reaction held on 11/4/2025 and it was a single reaction
  • Annealing temperature of 55 degrees C.
  • Our second gel image was taken on 11/4 and was run at 125 volts for 25 minutes.
  • The DNA ladder we use is, New England 1 kb plus DNA ladder for safe stains (#N0559S)

Results –

I am high-moderate confident that Arthropod 2 (Pillbug) is infected with Wolbachia. On the other hand, on the first PCR testing I determined that Arthropod 1 (Stink Bug) did not had Wolbachia. Today, I am moderate confident that Arthropod 1 may be infected.

 

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

Based on the first PCR, I would say my confidence level is moderate when it comes to determining if the samples were infected with Wolbachia. The controls mostly worked, which helps me trust the results. The positive control showed a clear band, meaning the PCR worked the way it should. The negative control and water lane didn’t show any bands, so there probably wasn’t any contamination. The only issue is that the bands for the arthropod samples are pretty faint compared to the positive control. That makes it harder to be sure whether the DNA shows Wolbachia or not. Because of that, I feel somewhat confident but not completely certain about the results.

After the second PCR reaction, I am high-moderate confident that Arthropod 2 (Pillbug) is infected with Wolbachia. On the other hand, on the first PCR testing I determined that Arthropod 1 (Stink Bug) did not have Wolbachia. Today, I am moderate confident that Arthropod 1 may be infected.

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
ATATGATCTGGAATAGTAGGATCAGCTATAAGATTAATTATCCGTATCGAATTAGGACAGCCTGGAAGATTTATTGGTAATGATCAAATTTATAATGTAATTGTAACAGCACATGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATAATTGGAGGATTCGGTAATTGATTAGTCCCTTTAATAATTGGAGCACCTGATATAGCCTTCCCACGATTAAATAATATAAGATTCTGATTATTACCCCCTTCATTAACTTTATTATTAATAAGAAGAATAGCAGAATCAGGAGCTGGGACAGGATGAACAGTCTATCCCCCCTTATCAAGTAATATCTCACATAGAGGAGCATCAGTTGATTTAGCTATTTTTTCCTTACATTTGGCTGGGGTTTCATCAATTTTAGGGGCAGTAAATTTTATTTCAACTATTATAAATATACGACCAACAGGTATAACCCCTGAACGAATCCCATTGTTTGTGTGATCAGTAGGAATTACTGCACTTCTTCTGTTATTATCCTTACCTGTGTTAGCAGGTGCTATTACTATACTATTAACTGACCGAAATTTTAATACCTCTTTTTTTGACCCATCAGGAGGAGGAGACCCTATTCTTTATCAACATTTATTTTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Halyomorpha halys was found to be negative for Wolbachia.
Report Inappropriate Post