Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 09/02/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Benedictine University |
| Observations | Collected by fall 2025 students with a killing jar nearby trees and tall grass. |
| Putative identification | Arthropoda Insecta Orthoptera Acrididae Melanoplus |
Methods |
|
| Extraction kit | DNeasy (Qiagen) blood and tissue kit. |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Single Reaction |
| Gel electrophoresis system | Standard electrophoresis system |
| Buffer | TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | DNA was isolated out of the insect abdomen with the use of the DNeasy (Qiagen) Blood and Tissue Kit in accordance with the standard protocol. Tissue was lysed in Buffer ATL containing Proteinase K and incubated until digested, then attached to a silica column, rinsed with Buffers AW1 and AW2 and washed off into AE buffer. A single reaction of PCR amplification was done and the 16S and COI amplifications were run separately under thermal cycling. PCR products were separated on an agarose gel by the use of a standard electrophoresis system utilizing the TAE buffer. The DNA stain was SYBR Safe. Samples were loaded and a molecular weight was used to confirm anticipated band sizes. Electrophoresis was performed, followed by visualization of gels in the blue light transilluminator, and imaging was done. The presence or absence of the band was taken to assess the presence of Wolbachia in the insect and the samples with clear and distinct bands were sequenced. Where feasible, sequence quality and results of BLAST were done to establish the level of confidence in the identification of Wolbachia. |
Results |
|
| Wolbachia presence | No |
| Confidence level | High |
| Explanation of confidence level | Had a thick COI gel band, but no Wolbachia gel band. This was also compared to the controls of W- and W+ as W- showed a band for COI, but not for Wolbachia and W+ showed a COI band and a Wolbachia band. The blast had a 100 percent identity for Melanoplus species and an e-value of 0.0 confirming my results. |
| Wolbachia 16S sequence | Download FASTA
Download AB1
>60-DW_B4_WoR.scf (311 bp) TCGAGTTGCAGAGTACAATCCGAACTGAGATGTCTTTTAGGGATTAGCTTAGGCTTGCGCACCTTGCAACCCATTGTAGA CACCATTGTAGCACGTGTGTAGCCCACTNNATAAAGGCCATGATGACTTGACATCATCCCCACCTTCCTCCAGCTTATCA CTGGCAGTTTCCTTAAAGTACTCAGCATTACCTGATAGCAACTAAGGATGAGGGTTGCNNTCGTTGCGGGACTTAACCCA ACATCTCACGACACGAGCTGACGACAGCCATGCAACACTTGNGNNAAATCCGGCCGAACCGACCCTATCCC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Arthropod COI sequence | Download FASTA
Download AB1
>11-DA_V2_CoR.scf (571 bp) GTATTTAAATTTCGATCAGTTAATAATATTGTAATAGCTCCTGCTAATACAGGAAGTGATAATAATAAAAGGAGTGCTGT AATAGCTACTGATCAAACAAATAATGGTGTTTGGTCTAGTGTTATTCTTTCTGATCGTATATTAATTGCTGTTGTAATAA AATTGACTGCCCCTAGAATTGATGAAACACCAGCTAAGTGAAGAGAGAAAATGGCTAAATCAACTGACGCTCCACCATGT GCAATTGCTCCAGCGAGTGGGGGGTAAACTGTTCATCCTGTACCAGCTCCATTATCAACCATAGATGAGGTAAGTAAAAG GGTTAGTGATGGTGGTAAAAGTCAAAAACTTATATTATTTATTCGTGGAAAAGCTATATCTGGTGCTCCAATTATTAATG GTACAAGTCAATTACCAAATCCTCCAATTATAATAGGTATTACTATAAAGAAAATTATTACAAATGCGTGGGCTGTAATA ATTACATTATAGATTTGGTCATCTCCAATTAGAGATCCTGGTTGTCCTAGTTCTGCTCGAATAATTATTCTTATAGAAGT TCCTACTATTC
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Melanoplus was found to be negative for Wolbachia. |



Ant
Stink Bug
Pillbug 2
Pill bug #3