Sample information |
|
| Picture |
|
|---|---|
| Location | |
| Collection date | 10/01/2025 |
| Captive / Cultivated? | Wild-caught |
| Group | Berkshire Community College |
| Observations | The ant is small in size. It is about 3–5 mm long, with a slender, evenly oval body. Its coloration is uniformly dark brown to black with a smooth, slightly glossy appearance to the head, thorax, and gaster. The antennae are elbowed with a distinct club, and the legs are relatively long and pale brown to dark brown. The body has fine hairs but lacks obvious spines. |
| Putative identification | Arthropoda Insecta Hymenoptera Formicidae Formica Formica glacialis |
Methods |
|
| Extraction kit | Monarch DNA extraction (NEB) |
| DNA extraction location | Abdomen |
| Single or Duplex PCR | Duplex Reaction |
| Gel electrophoresis system | Edvotek Gel Electrophoresis |
| Buffer | 1X TAE |
| DNA stain | SYBR Safe |
| Gel images |
|
| Protocol notes | We used a DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction kit (Product # T3010). The specimen was incubated for 40minutes in a hot water bath at 56 degrees C. Our first PCR reaction was set up on 10/14/2025 and:
|
Results |
|
| Wolbachia presence | No |
| Confidence level | Medium |
| Explanation of confidence level | Results for the 4 control lanes matched expectations after the duplex PCR because both positive arthropod and positive DNA controls had the 708bp and 438bp bands which represent the CO1 and 16sRNA genes respectively. The negative arthropod control had only the 708bp representing CO1 gene and the water also showed no signs of contamination, confidently confirming that the experimental results are valid. After the single PCR for Wolbachia F and R primers, the confidence level lowered because the water control lane showed contamination. After DNA sequencing, we determined that the labels for the black ant and bumblebee on the gel images had been switched accidentally. |
| Wolbachia 16S sequence | |
| Arthropod COI sequence | Download AB1
GAGCAGGAATAATTGGGTCTTCTATAAGTATAATTATTCGTTTAGAATTAGGTTCATCTAATTCATTAATCAATAATGATCAAATTTATAATTCTTTAGTAACTAATCACGCTTTTATTATAATTTTTTTCATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCTTTAATACTAGGATCACCAGACATAGCATACCCTCGTATAAATAATATAAGATTTTGACTCTTACCTCCTTCAATTACTCTTTTACTTTTAAGAAATTTTATTAATGATGGAACAGGGACAGGATGAACTATTTATCCTCCTTTATCCTCTAATATTTTTCATAATGGTCCTTCTGTAGATTTAACAATTTTTTCTCTTCATATTGCAGGTATATCCTCAATTTTAGGAGCAATTAATTTTATTTCAACAATTCTTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCTTTACTCGTATGATCAATTTTAATTACAGCTATCTTACTCCTATTATCATTACCTGTCTTAGCCGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCTTCAGGAGGAGGTGATCCAATTCTATACCAACATTTATTTTGA
BLAST at The Wolbachia Project BLAST at NCBI
|
| Summary | The Formica glacialis was found to be negative for Wolbachia. |








Umbrella Wasp
Fannia Canicularis
Oulema Obsucra JM2
Collembola
Linyphiidae BK1