Black Ant

Sample information

Picture
Entry by: Josiah O
Location
Collection date 10/01/2025
Captive / Cultivated? Wild-caught
Group Berkshire Community College
Observations

The ant is small in size. It is about 3–5 mm long, with a slender, evenly oval body. Its coloration is uniformly dark brown to black with a smooth, slightly glossy appearance to the head, thorax, and gaster. The antennae are elbowed with a distinct club, and the legs are relatively long and pale brown to dark brown. The body has fine hairs but lacks obvious spines.

Putative identification Arthropoda Insecta Hymenoptera Formicidae Formica Formica glacialis

Methods

Extraction kit Monarch DNA extraction (NEB)
DNA extraction location Abdomen
Single or Duplex PCR Duplex Reaction
Gel electrophoresis system Edvotek Gel Electrophoresis
Buffer 1X TAE
DNA stain SYBR Safe
Gel images
Protocol notes

We used a DNA extraction protocol based on the insect adaptation of New England Biolabs’ Monarch Spin gDNA Extraction kit (Product # T3010). The specimen was incubated for 40minutes in a hot water bath at 56 degrees C.

Our first PCR reaction was set up on 10/14/2025 and:

  • was a duplex reaction because we used both the Arthropod CO1 and Wolbachia 16S primers together.
  • used an annealing temperature of   49  degrees Celsius.
  • used this Taq polymerase: New England Biolabs OneTaq Hot Start Quick-Load 2X Master Mix with Standard Buffer (#M0488S
  • Our first Gel image was taken on 10/22/25 and:
    • was run at 125volts for 24 minutes
    • used this DNA Ladder: New England Biolabs 1 kb Plus DNA Ladder for Safe Stains (product # N0559S)
  • The second PCR reaction was set up on 10/29/25, used the same Taq polymerase as the first PCR reaction, and:
  • was a single PCR reaction that used the Wolbachia 16S F and 16S R primer(s).
  • used an annealing temperature of  55 degrees Celsius.
  • Our second Gel image was taken on 11/5/2025 (date) and:
    • was run at 125 volts for 22 minutes
    • used this DNA Ladder: New England Biolabs 1 kb Plus DNA Ladder for Safe Stains (product # N0559S)

Results

Wolbachia presence No
Confidence level Medium
Explanation of confidence level

Results for the 4 control lanes matched expectations after the duplex PCR because both positive arthropod and positive DNA controls had the 708bp and 438bp bands which represent the CO1 and 16sRNA genes respectively. The negative arthropod control had only the 708bp representing CO1 gene and the water also showed no signs of contamination, confidently confirming that the experimental results are valid.

After the single PCR for Wolbachia F and R primers, the confidence level lowered because the water control lane showed contamination.

After DNA sequencing, we determined that the labels for the black ant and bumblebee on the gel images had been switched accidentally.

Wolbachia 16S sequence
Arthropod COI sequence Download AB1
GAGCAGGAATAATTGGGTCTTCTATAAGTATAATTATTCGTTTAGAATTAGGTTCATCTAATTCATTAATCAATAATGATCAAATTTATAATTCTTTAGTAACTAATCACGCTTTTATTATAATTTTTTTCATAGTAATACCATTTATAATTGGTGGATTTGGAAATTTTCTAATTCCTTTAATACTAGGATCACCAGACATAGCATACCCTCGTATAAATAATATAAGATTTTGACTCTTACCTCCTTCAATTACTCTTTTACTTTTAAGAAATTTTATTAATGATGGAACAGGGACAGGATGAACTATTTATCCTCCTTTATCCTCTAATATTTTTCATAATGGTCCTTCTGTAGATTTAACAATTTTTTCTCTTCATATTGCAGGTATATCCTCAATTTTAGGAGCAATTAATTTTATTTCAACAATTCTTAATATACATCATAAAAATTTTTCTATTGATAAAATTCCTTTACTCGTATGATCAATTTTAATTACAGCTATCTTACTCCTATTATCATTACCTGTCTTAGCCGGAGCTATTACTATACTATTAACTGATCGAAATTTAAATACTTCATTCTTTGATCCTTCAGGAGGAGGTGATCCAATTCTATACCAACATTTATTTTGA
BLAST at The Wolbachia Project   BLAST at NCBI
Summary The Formica glacialis was found to be negative for Wolbachia.
Report Inappropriate Post